ID: 996459424

View in Genome Browser
Species Human (GRCh38)
Location 5:123724728-123724750
Sequence AGGGAGAGTGCAGCGACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996459410_996459424 19 Left 996459410 5:123724686-123724708 CCAGCAATGGCCATGCAGCATGG No data
Right 996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG No data
996459409_996459424 20 Left 996459409 5:123724685-123724707 CCCAGCAATGGCCATGCAGCATG No data
Right 996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG No data
996459408_996459424 21 Left 996459408 5:123724684-123724706 CCCCAGCAATGGCCATGCAGCAT No data
Right 996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG No data
996459414_996459424 9 Left 996459414 5:123724696-123724718 CCATGCAGCATGGAGGGTCTATG No data
Right 996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG No data
996459407_996459424 22 Left 996459407 5:123724683-123724705 CCCCCAGCAATGGCCATGCAGCA No data
Right 996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996459424 Original CRISPR AGGGAGAGTGCAGCGACCGG GGG Intergenic
No off target data available for this crispr