ID: 996461447

View in Genome Browser
Species Human (GRCh38)
Location 5:123748452-123748474
Sequence GGTGACACCAATAGACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996461447_996461449 -6 Left 996461447 5:123748452-123748474 CCTTCCTGTCTATTGGTGTCACC No data
Right 996461449 5:123748469-123748491 GTCACCACTTAAATGTCCTCAGG No data
996461447_996461453 19 Left 996461447 5:123748452-123748474 CCTTCCTGTCTATTGGTGTCACC No data
Right 996461453 5:123748494-123748516 TCTCAAATCTGGAGTGCTCAAGG No data
996461447_996461451 8 Left 996461447 5:123748452-123748474 CCTTCCTGTCTATTGGTGTCACC No data
Right 996461451 5:123748483-123748505 GTCCTCAGGCTTCTCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996461447 Original CRISPR GGTGACACCAATAGACAGGA AGG (reversed) Intergenic
No off target data available for this crispr