ID: 996463232

View in Genome Browser
Species Human (GRCh38)
Location 5:123770892-123770914
Sequence ATTTTGGCCTGCTGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996463232_996463239 24 Left 996463232 5:123770892-123770914 CCCTGGATCCAGCAGGCCAAAAT No data
Right 996463239 5:123770939-123770961 TCTAGCATTTCTTGTAAGACAGG No data
996463232_996463240 29 Left 996463232 5:123770892-123770914 CCCTGGATCCAGCAGGCCAAAAT No data
Right 996463240 5:123770944-123770966 CATTTCTTGTAAGACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996463232 Original CRISPR ATTTTGGCCTGCTGGATCCA GGG (reversed) Intergenic
No off target data available for this crispr