ID: 996464484

View in Genome Browser
Species Human (GRCh38)
Location 5:123783439-123783461
Sequence GTCCCAGGGCACAAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996464476_996464484 1 Left 996464476 5:123783415-123783437 CCTTGGGAAGGTGAAAGGGGAGG No data
Right 996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG No data
996464469_996464484 29 Left 996464469 5:123783387-123783409 CCATATGGGAGGAAAGCTGGAGA No data
Right 996464484 5:123783439-123783461 GTCCCAGGGCACAAGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996464484 Original CRISPR GTCCCAGGGCACAAGTGGAA GGG Intergenic
No off target data available for this crispr