ID: 996482506

View in Genome Browser
Species Human (GRCh38)
Location 5:123990869-123990891
Sequence CCAAACCCTGCTTTTTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996482506_996482513 20 Left 996482506 5:123990869-123990891 CCTAAAAAAAAAGCAGGGTTTGG No data
Right 996482513 5:123990912-123990934 CTAGGAAGGGCCAGGCGCAGTGG No data
996482506_996482511 7 Left 996482506 5:123990869-123990891 CCTAAAAAAAAAGCAGGGTTTGG No data
Right 996482511 5:123990899-123990921 GGTTTAAAAAATGCTAGGAAGGG No data
996482506_996482512 12 Left 996482506 5:123990869-123990891 CCTAAAAAAAAAGCAGGGTTTGG No data
Right 996482512 5:123990904-123990926 AAAAAATGCTAGGAAGGGCCAGG No data
996482506_996482509 2 Left 996482506 5:123990869-123990891 CCTAAAAAAAAAGCAGGGTTTGG No data
Right 996482509 5:123990894-123990916 ACAGAGGTTTAAAAAATGCTAGG No data
996482506_996482510 6 Left 996482506 5:123990869-123990891 CCTAAAAAAAAAGCAGGGTTTGG No data
Right 996482510 5:123990898-123990920 AGGTTTAAAAAATGCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996482506 Original CRISPR CCAAACCCTGCTTTTTTTTT AGG (reversed) Intergenic
No off target data available for this crispr