ID: 996484156

View in Genome Browser
Species Human (GRCh38)
Location 5:124011837-124011859
Sequence CCAACATTGTAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996484156_996484162 7 Left 996484156 5:124011837-124011859 CCATCCTCCCTCTACAATGTTGG No data
Right 996484162 5:124011867-124011889 CTGATGCCCATCATCCTCTTGGG No data
996484156_996484165 13 Left 996484156 5:124011837-124011859 CCATCCTCCCTCTACAATGTTGG No data
Right 996484165 5:124011873-124011895 CCCATCATCCTCTTGGGCAAGGG No data
996484156_996484163 12 Left 996484156 5:124011837-124011859 CCATCCTCCCTCTACAATGTTGG No data
Right 996484163 5:124011872-124011894 GCCCATCATCCTCTTGGGCAAGG No data
996484156_996484161 6 Left 996484156 5:124011837-124011859 CCATCCTCCCTCTACAATGTTGG No data
Right 996484161 5:124011866-124011888 GCTGATGCCCATCATCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996484156 Original CRISPR CCAACATTGTAGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr