ID: 996487724

View in Genome Browser
Species Human (GRCh38)
Location 5:124056495-124056517
Sequence CAGAGGTATTTTCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996487718_996487724 19 Left 996487718 5:124056453-124056475 CCAACAACTCGGCAATGGACTGT No data
Right 996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG No data
996487716_996487724 29 Left 996487716 5:124056443-124056465 CCTGTCATGGCCAACAACTCGGC No data
Right 996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG No data
996487714_996487724 30 Left 996487714 5:124056442-124056464 CCCTGTCATGGCCAACAACTCGG No data
Right 996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996487724 Original CRISPR CAGAGGTATTTTCAGTTGGT GGG Intergenic
No off target data available for this crispr