ID: 996488511

View in Genome Browser
Species Human (GRCh38)
Location 5:124065156-124065178
Sequence GAGTATGAGATCATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996488509_996488511 -8 Left 996488509 5:124065141-124065163 CCTCTAAGGTCAGCAGAGTATGA No data
Right 996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG No data
996488506_996488511 8 Left 996488506 5:124065125-124065147 CCCTTTGGAACTAAGACCTCTAA No data
Right 996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG No data
996488507_996488511 7 Left 996488507 5:124065126-124065148 CCTTTGGAACTAAGACCTCTAAG No data
Right 996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG No data
996488504_996488511 26 Left 996488504 5:124065107-124065129 CCTGGTGGAAACATTTCTCCCTT No data
Right 996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996488511 Original CRISPR GAGTATGAGATCATGGAGAC AGG Intergenic
No off target data available for this crispr