ID: 996488800

View in Genome Browser
Species Human (GRCh38)
Location 5:124067982-124068004
Sequence TGGGTCTCTTTGGGAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996488793_996488800 8 Left 996488793 5:124067951-124067973 CCCAGTGAACAGTCACTCTGGTA No data
Right 996488800 5:124067982-124068004 TGGGTCTCTTTGGGAAAGGCTGG No data
996488791_996488800 15 Left 996488791 5:124067944-124067966 CCTTTTTCCCAGTGAACAGTCAC No data
Right 996488800 5:124067982-124068004 TGGGTCTCTTTGGGAAAGGCTGG No data
996488794_996488800 7 Left 996488794 5:124067952-124067974 CCAGTGAACAGTCACTCTGGTAA No data
Right 996488800 5:124067982-124068004 TGGGTCTCTTTGGGAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996488800 Original CRISPR TGGGTCTCTTTGGGAAAGGC TGG Intergenic
No off target data available for this crispr