ID: 996489264

View in Genome Browser
Species Human (GRCh38)
Location 5:124073474-124073496
Sequence TAAAACACACAGATGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996489264_996489265 -4 Left 996489264 5:124073474-124073496 CCAGGCTGCATCTGTGTGTTTTA No data
Right 996489265 5:124073493-124073515 TTTAAATGAAAGTCTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996489264 Original CRISPR TAAAACACACAGATGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr