ID: 996491440

View in Genome Browser
Species Human (GRCh38)
Location 5:124102642-124102664
Sequence ATACATAAACAAATGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996491434_996491440 5 Left 996491434 5:124102614-124102636 CCTTTTAGCAAGAAAGTACCCAT No data
Right 996491440 5:124102642-124102664 ATACATAAACAAATGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996491440 Original CRISPR ATACATAAACAAATGGAGTG TGG Intergenic
No off target data available for this crispr