ID: 996491549

View in Genome Browser
Species Human (GRCh38)
Location 5:124104072-124104094
Sequence GACCTTGATTTCCATAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996491548_996491549 -9 Left 996491548 5:124104058-124104080 CCTTGTGCTATACAGACCTTGAT No data
Right 996491549 5:124104072-124104094 GACCTTGATTTCCATAATCCAGG No data
996491547_996491549 7 Left 996491547 5:124104042-124104064 CCAGAGTCATAAAATACCTTGTG No data
Right 996491549 5:124104072-124104094 GACCTTGATTTCCATAATCCAGG No data
996491546_996491549 10 Left 996491546 5:124104039-124104061 CCTCCAGAGTCATAAAATACCTT No data
Right 996491549 5:124104072-124104094 GACCTTGATTTCCATAATCCAGG No data
996491545_996491549 28 Left 996491545 5:124104021-124104043 CCTGAAACATATACTTTTCCTCC No data
Right 996491549 5:124104072-124104094 GACCTTGATTTCCATAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996491549 Original CRISPR GACCTTGATTTCCATAATCC AGG Intergenic
No off target data available for this crispr