ID: 996491729

View in Genome Browser
Species Human (GRCh38)
Location 5:124105860-124105882
Sequence TGGGAATCTCTTGAAAGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996491728_996491729 -10 Left 996491728 5:124105847-124105869 CCAGAAGAATGATTGGGAATCTC No data
Right 996491729 5:124105860-124105882 TGGGAATCTCTTGAAAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996491729 Original CRISPR TGGGAATCTCTTGAAAGAAC CGG Intergenic
No off target data available for this crispr