ID: 996494658

View in Genome Browser
Species Human (GRCh38)
Location 5:124139949-124139971
Sequence ATTATAAAACAGTTTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996494655_996494658 1 Left 996494655 5:124139925-124139947 CCACCTGAAATAACCAAAAAATA No data
Right 996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG No data
996494656_996494658 -2 Left 996494656 5:124139928-124139950 CCTGAAATAACCAAAAAATATAT No data
Right 996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG No data
996494652_996494658 15 Left 996494652 5:124139911-124139933 CCAGATTTACCCTACCACCTGAA 0: 2
1: 8
2: 18
3: 61
4: 176
Right 996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG No data
996494654_996494658 5 Left 996494654 5:124139921-124139943 CCTACCACCTGAAATAACCAAAA No data
Right 996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG No data
996494653_996494658 6 Left 996494653 5:124139920-124139942 CCCTACCACCTGAAATAACCAAA No data
Right 996494658 5:124139949-124139971 ATTATAAAACAGTTTTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996494658 Original CRISPR ATTATAAAACAGTTTTCAGT AGG Intergenic
No off target data available for this crispr