ID: 996501395

View in Genome Browser
Species Human (GRCh38)
Location 5:124220560-124220582
Sequence AAGAAAAAGAAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996501395_996501399 19 Left 996501395 5:124220560-124220582 CCCTCCTCTTTCTTCTTTTTCTT No data
Right 996501399 5:124220602-124220624 ACTCCCTTTTTTGCTGCATCAGG 0: 12
1: 5
2: 9
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996501395 Original CRISPR AAGAAAAAGAAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr