ID: 996503385

View in Genome Browser
Species Human (GRCh38)
Location 5:124241651-124241673
Sequence GGGTATAGTGCAATTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996503385_996503391 16 Left 996503385 5:124241651-124241673 CCAGGTACAATTGCACTATACCC No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data
996503385_996503390 12 Left 996503385 5:124241651-124241673 CCAGGTACAATTGCACTATACCC No data
Right 996503390 5:124241686-124241708 TAGATAGGACAGGCCTAATGAGG No data
996503385_996503389 2 Left 996503385 5:124241651-124241673 CCAGGTACAATTGCACTATACCC No data
Right 996503389 5:124241676-124241698 GTTAAATCAATAGATAGGACAGG No data
996503385_996503387 -3 Left 996503385 5:124241651-124241673 CCAGGTACAATTGCACTATACCC No data
Right 996503387 5:124241671-124241693 CCCATGTTAAATCAATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996503385 Original CRISPR GGGTATAGTGCAATTGTACC TGG (reversed) Intergenic
No off target data available for this crispr