ID: 996503386

View in Genome Browser
Species Human (GRCh38)
Location 5:124241671-124241693
Sequence CCTATCTATTGATTTAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996503386_996503390 -8 Left 996503386 5:124241671-124241693 CCCATGTTAAATCAATAGATAGG No data
Right 996503390 5:124241686-124241708 TAGATAGGACAGGCCTAATGAGG No data
996503386_996503391 -4 Left 996503386 5:124241671-124241693 CCCATGTTAAATCAATAGATAGG No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data
996503386_996503394 26 Left 996503386 5:124241671-124241693 CCCATGTTAAATCAATAGATAGG No data
Right 996503394 5:124241720-124241742 AGATCCCTATTTTACAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996503386 Original CRISPR CCTATCTATTGATTTAACAT GGG (reversed) Intergenic
No off target data available for this crispr