ID: 996503388

View in Genome Browser
Species Human (GRCh38)
Location 5:124241672-124241694
Sequence TCCTATCTATTGATTTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996503388_996503394 25 Left 996503388 5:124241672-124241694 CCATGTTAAATCAATAGATAGGA No data
Right 996503394 5:124241720-124241742 AGATCCCTATTTTACAAATAAGG No data
996503388_996503390 -9 Left 996503388 5:124241672-124241694 CCATGTTAAATCAATAGATAGGA No data
Right 996503390 5:124241686-124241708 TAGATAGGACAGGCCTAATGAGG No data
996503388_996503391 -5 Left 996503388 5:124241672-124241694 CCATGTTAAATCAATAGATAGGA No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996503388 Original CRISPR TCCTATCTATTGATTTAACA TGG (reversed) Intergenic
No off target data available for this crispr