ID: 996503391

View in Genome Browser
Species Human (GRCh38)
Location 5:124241690-124241712
Sequence TAGGACAGGCCTAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996503385_996503391 16 Left 996503385 5:124241651-124241673 CCAGGTACAATTGCACTATACCC No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data
996503388_996503391 -5 Left 996503388 5:124241672-124241694 CCATGTTAAATCAATAGATAGGA No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data
996503386_996503391 -4 Left 996503386 5:124241671-124241693 CCCATGTTAAATCAATAGATAGG No data
Right 996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996503391 Original CRISPR TAGGACAGGCCTAATGAGGC AGG Intergenic
No off target data available for this crispr