ID: 996506465

View in Genome Browser
Species Human (GRCh38)
Location 5:124273311-124273333
Sequence ACTGATATGAAAACAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996506460_996506465 5 Left 996506460 5:124273283-124273305 CCAAGACAAGTGTACTCAAAACA No data
Right 996506465 5:124273311-124273333 ACTGATATGAAAACAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996506465 Original CRISPR ACTGATATGAAAACAGTGGG GGG Intergenic
No off target data available for this crispr