ID: 996506852

View in Genome Browser
Species Human (GRCh38)
Location 5:124277359-124277381
Sequence ATCAGCCAGGCATCCCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996506852_996506858 24 Left 996506852 5:124277359-124277381 CCTAATTGGGATGCCTGGCTGAT No data
Right 996506858 5:124277406-124277428 GTGGTAAAGAAAAATTCCGAAGG No data
996506852_996506857 5 Left 996506852 5:124277359-124277381 CCTAATTGGGATGCCTGGCTGAT No data
Right 996506857 5:124277387-124277409 GGGTTAGAAGTAATAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996506852 Original CRISPR ATCAGCCAGGCATCCCAATT AGG (reversed) Intergenic
No off target data available for this crispr