ID: 996507290

View in Genome Browser
Species Human (GRCh38)
Location 5:124282169-124282191
Sequence CACCAATAGAAGCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996507283_996507290 22 Left 996507283 5:124282124-124282146 CCCAGCTGCACCTGCACGTCTCC No data
Right 996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG No data
996507284_996507290 21 Left 996507284 5:124282125-124282147 CCAGCTGCACCTGCACGTCTCCA No data
Right 996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG No data
996507287_996507290 1 Left 996507287 5:124282145-124282167 CCACTTTTCACAGCCTGAGGTAA No data
Right 996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG No data
996507285_996507290 12 Left 996507285 5:124282134-124282156 CCTGCACGTCTCCACTTTTCACA No data
Right 996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996507290 Original CRISPR CACCAATAGAAGCTTGATCT TGG Intergenic
No off target data available for this crispr