ID: 996507852

View in Genome Browser
Species Human (GRCh38)
Location 5:124288111-124288133
Sequence CGAATGGTGGGGAGCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996507852_996507857 11 Left 996507852 5:124288111-124288133 CCTTCTTGGCTCCCCACCATTCG No data
Right 996507857 5:124288145-124288167 TGTGTCCCTGTTCACTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996507852 Original CRISPR CGAATGGTGGGGAGCCAAGA AGG (reversed) Intergenic
No off target data available for this crispr