ID: 996510384

View in Genome Browser
Species Human (GRCh38)
Location 5:124309460-124309482
Sequence CACACAGACACACATGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996510379_996510384 30 Left 996510379 5:124309407-124309429 CCCACGTGATTAAAAGCTTTATT No data
Right 996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG No data
996510380_996510384 29 Left 996510380 5:124309408-124309430 CCACGTGATTAAAAGCTTTATTG No data
Right 996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG No data
996510383_996510384 -5 Left 996510383 5:124309442-124309464 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996510384 Original CRISPR CACACAGACACACATGAAAA CGG Intergenic
No off target data available for this crispr