ID: 996516325

View in Genome Browser
Species Human (GRCh38)
Location 5:124373404-124373426
Sequence GAGTGGTAATAGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996516325_996516330 27 Left 996516325 5:124373404-124373426 CCATCTTCTTTCTATTACCACTC No data
Right 996516330 5:124373454-124373476 CCTATAAGACACAGTCTGATGGG No data
996516325_996516328 26 Left 996516325 5:124373404-124373426 CCATCTTCTTTCTATTACCACTC No data
Right 996516328 5:124373453-124373475 TCCTATAAGACACAGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996516325 Original CRISPR GAGTGGTAATAGAAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr