ID: 996521678

View in Genome Browser
Species Human (GRCh38)
Location 5:124434456-124434478
Sequence ATCTTGAATTAGAAGAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996521675_996521678 -5 Left 996521675 5:124434438-124434460 CCCTGAATAAACAAAGCCATCTT No data
Right 996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG No data
996521674_996521678 23 Left 996521674 5:124434410-124434432 CCTAAAATATGTGTGAAATCACT No data
Right 996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG No data
996521676_996521678 -6 Left 996521676 5:124434439-124434461 CCTGAATAAACAAAGCCATCTTG No data
Right 996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996521678 Original CRISPR ATCTTGAATTAGAAGAACTA AGG Intergenic
No off target data available for this crispr