ID: 996524497

View in Genome Browser
Species Human (GRCh38)
Location 5:124463675-124463697
Sequence GACACAGCAGCTCCTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996524490_996524497 28 Left 996524490 5:124463624-124463646 CCTTCCATCACTAGCCCTCTTTT No data
Right 996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG No data
996524493_996524497 14 Left 996524493 5:124463638-124463660 CCCTCTTTTAGGCTCACTTACAC No data
Right 996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG No data
996524494_996524497 13 Left 996524494 5:124463639-124463661 CCTCTTTTAGGCTCACTTACACT No data
Right 996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG No data
996524492_996524497 24 Left 996524492 5:124463628-124463650 CCATCACTAGCCCTCTTTTAGGC No data
Right 996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996524497 Original CRISPR GACACAGCAGCTCCTCAGTG AGG Intergenic
No off target data available for this crispr