ID: 996526418

View in Genome Browser
Species Human (GRCh38)
Location 5:124484974-124484996
Sequence CCCCAGAGCCTAGACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996526416_996526418 -2 Left 996526416 5:124484953-124484975 CCTGTACTGGGGGAAGGAGGGCC No data
Right 996526418 5:124484974-124484996 CCCCAGAGCCTAGACTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996526418 Original CRISPR CCCCAGAGCCTAGACTGCAG AGG Intergenic
No off target data available for this crispr