ID: 996533455

View in Genome Browser
Species Human (GRCh38)
Location 5:124550780-124550802
Sequence ATTTCTCCCTAGTTTAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996533451_996533455 17 Left 996533451 5:124550740-124550762 CCAGAGCTGACAAAGTCCACAGT No data
Right 996533455 5:124550780-124550802 ATTTCTCCCTAGTTTAGGTAAGG No data
996533452_996533455 1 Left 996533452 5:124550756-124550778 CCACAGTCTGAAGCCTGCTTTAT No data
Right 996533455 5:124550780-124550802 ATTTCTCCCTAGTTTAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996533455 Original CRISPR ATTTCTCCCTAGTTTAGGTA AGG Intergenic
No off target data available for this crispr