ID: 996535905

View in Genome Browser
Species Human (GRCh38)
Location 5:124577572-124577594
Sequence AAGGCTTCTGGGAGACATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996535905_996535913 2 Left 996535905 5:124577572-124577594 CCCCAATGTCTCCCAGAAGCCTT No data
Right 996535913 5:124577597-124577619 CAAAGAGTAACTGTTCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996535905 Original CRISPR AAGGCTTCTGGGAGACATTG GGG (reversed) Intergenic
No off target data available for this crispr