ID: 996536774

View in Genome Browser
Species Human (GRCh38)
Location 5:124585703-124585725
Sequence CCTCATCAGCTTCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996536771_996536774 -7 Left 996536771 5:124585687-124585709 CCTTGTCTGCTCATCTCCTCATC No data
Right 996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG No data
996536768_996536774 27 Left 996536768 5:124585653-124585675 CCGTTCTGCTGTTCGTCTGCTTG No data
Right 996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG No data
996536770_996536774 1 Left 996536770 5:124585679-124585701 CCTGGTCTCCTTGTCTGCTCATC No data
Right 996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996536774 Original CRISPR CCTCATCAGCTTCTGGAGCC TGG Intergenic
No off target data available for this crispr