ID: 996536844

View in Genome Browser
Species Human (GRCh38)
Location 5:124586202-124586224
Sequence CTACTGCGGCAGGTAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996536840_996536844 0 Left 996536840 5:124586179-124586201 CCTCTGAAGCAGAAGTTTTTATC No data
Right 996536844 5:124586202-124586224 CTACTGCGGCAGGTAAGCCCAGG No data
996536839_996536844 20 Left 996536839 5:124586159-124586181 CCTGTTATTCTTTCTTGTTTCCT No data
Right 996536844 5:124586202-124586224 CTACTGCGGCAGGTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996536844 Original CRISPR CTACTGCGGCAGGTAAGCCC AGG Intergenic
No off target data available for this crispr