ID: 996538439

View in Genome Browser
Species Human (GRCh38)
Location 5:124603339-124603361
Sequence ATCAGCTTCAAGTGATTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996538439_996538442 22 Left 996538439 5:124603339-124603361 CCTAATAATCACTTGAAGCTGAT No data
Right 996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG No data
996538439_996538441 12 Left 996538439 5:124603339-124603361 CCTAATAATCACTTGAAGCTGAT No data
Right 996538441 5:124603374-124603396 ATTCTCTTCTTCACAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996538439 Original CRISPR ATCAGCTTCAAGTGATTATT AGG (reversed) Intergenic
No off target data available for this crispr