ID: 996538440

View in Genome Browser
Species Human (GRCh38)
Location 5:124603369-124603391
Sequence CTCTGTGAAGAAGAGAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996538440_996538444 24 Left 996538440 5:124603369-124603391 CCATTATTCTCTTCTTCACAGAG No data
Right 996538444 5:124603416-124603438 AGCTTCTCTCCCTAAGTTGCAGG No data
996538440_996538442 -8 Left 996538440 5:124603369-124603391 CCATTATTCTCTTCTTCACAGAG No data
Right 996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996538440 Original CRISPR CTCTGTGAAGAAGAGAATAA TGG (reversed) Intergenic
No off target data available for this crispr