ID: 996538442

View in Genome Browser
Species Human (GRCh38)
Location 5:124603384-124603406
Sequence TCACAGAGCATGGAAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996538440_996538442 -8 Left 996538440 5:124603369-124603391 CCATTATTCTCTTCTTCACAGAG No data
Right 996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG No data
996538439_996538442 22 Left 996538439 5:124603339-124603361 CCTAATAATCACTTGAAGCTGAT No data
Right 996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996538442 Original CRISPR TCACAGAGCATGGAAAAAAC TGG Intergenic
No off target data available for this crispr