ID: 996538620

View in Genome Browser
Species Human (GRCh38)
Location 5:124605650-124605672
Sequence CTCTGCTTACATAGTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996538618_996538620 2 Left 996538618 5:124605625-124605647 CCATGAATGAGATCATGTCAACT No data
Right 996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG No data
996538614_996538620 26 Left 996538614 5:124605601-124605623 CCCTGACACAAAGAGAAGAAAGG No data
Right 996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG No data
996538616_996538620 25 Left 996538616 5:124605602-124605624 CCTGACACAAAGAGAAGAAAGGC No data
Right 996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG No data
996538617_996538620 3 Left 996538617 5:124605624-124605646 CCCATGAATGAGATCATGTCAAC No data
Right 996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996538620 Original CRISPR CTCTGCTTACATAGTAATGC TGG Intergenic
No off target data available for this crispr