ID: 996538912

View in Genome Browser
Species Human (GRCh38)
Location 5:124608555-124608577
Sequence CAGAGTGAAGAGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996538910_996538912 -2 Left 996538910 5:124608534-124608556 CCATTGTAAGCTCAAGAAGCTCA No data
Right 996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996538912 Original CRISPR CAGAGTGAAGAGAAGGCAGA TGG Intergenic
No off target data available for this crispr