ID: 996540886

View in Genome Browser
Species Human (GRCh38)
Location 5:124629343-124629365
Sequence CCTCAGCAGAGGGAACGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996540876_996540886 10 Left 996540876 5:124629310-124629332 CCATGAGTCATCCCTGCTTCAGC No data
Right 996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG No data
996540877_996540886 -1 Left 996540877 5:124629321-124629343 CCCTGCTTCAGCCCTCAGCAGCC No data
Right 996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG No data
996540875_996540886 15 Left 996540875 5:124629305-124629327 CCTCTCCATGAGTCATCCCTGCT No data
Right 996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG No data
996540878_996540886 -2 Left 996540878 5:124629322-124629344 CCTGCTTCAGCCCTCAGCAGCCC No data
Right 996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996540886 Original CRISPR CCTCAGCAGAGGGAACGGTC TGG Intergenic
No off target data available for this crispr