ID: 996542117

View in Genome Browser
Species Human (GRCh38)
Location 5:124641290-124641312
Sequence CACCACACCCACGTTGGCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996542117_996542126 9 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542126 5:124641322-124641344 CAGGTGCCGCTGGCCGAAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 133
996542117_996542124 7 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542124 5:124641320-124641342 TGCAGGTGCCGCTGGCCGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 104
996542117_996542123 6 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542123 5:124641319-124641341 GTGCAGGTGCCGCTGGCCGAAGG 0: 1
1: 0
2: 0
3: 16
4: 176
996542117_996542125 8 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542125 5:124641321-124641343 GCAGGTGCCGCTGGCCGAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 174
996542117_996542127 14 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542127 5:124641327-124641349 GCCGCTGGCCGAAGGGGGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 190
996542117_996542121 -10 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542121 5:124641303-124641325 GGGTGTGGTGGTGCGTGTGCAGG 0: 1
1: 0
2: 6
3: 84
4: 727
996542117_996542122 -1 Left 996542117 5:124641290-124641312 CCCATGCCAACGTGGGTGTGGTG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 996542122 5:124641312-124641334 GGTGCGTGTGCAGGTGCCGCTGG 0: 1
1: 0
2: 1
3: 24
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996542117 Original CRISPR CACCACACCCACGTTGGCAT GGG (reversed) Exonic
903812672 1:26043569-26043591 CCCAACACCCACCTTGGCATGGG + Intronic
909178798 1:72393929-72393951 AACCATACCCACTTTGGGATGGG - Intergenic
910362415 1:86426864-86426886 CACCAAAACCAGGTTGCCATAGG + Intronic
1063395562 10:5684609-5684631 CACCACGCGCTCGTTGGGATCGG + Intergenic
1064018151 10:11788447-11788469 AACCTCACCTATGTTGGCATCGG + Intergenic
1065606767 10:27426272-27426294 AACCACACCCACCTTGTCTTTGG - Intergenic
1067289872 10:44932847-44932869 CACCACACACACGCAGGAATGGG + Intronic
1070693929 10:78547846-78547868 CTTCACACCCATGTTGGAATGGG - Intergenic
1076348983 10:129801799-129801821 CTCCACACCCAGCTTGGCCTGGG - Intergenic
1084849088 11:71924223-71924245 CACCACACCCAGCTTAGCAAGGG - Intronic
1085668544 11:78439325-78439347 CACCGCACCCACGGTGGCTTTGG + Intronic
1092193913 12:6537765-6537787 CACCACTGACACGTTGGCAGTGG - Exonic
1099995256 12:89771305-89771327 AACCACACCCACTTTGCCTTTGG + Intergenic
1102470328 12:113156206-113156228 CACCACACCCAGCGTGACATAGG + Intronic
1107963741 13:45580835-45580857 CACCCCACCCTCTTTGGCTTTGG + Intronic
1110219597 13:73059260-73059282 CACCTCGCCCACGCTGGCTTGGG - Exonic
1111665820 13:91266917-91266939 CACCACACCCATGTCTCCATTGG + Intergenic
1117638761 14:57774948-57774970 CACCACACCACCATTGTCATTGG + Intronic
1126846656 15:52766601-52766623 CAGCACACCCATGCTGGCCTGGG + Intronic
1128146689 15:65335910-65335932 CTCCTCACCCACGGTGGCCTGGG + Exonic
1134784046 16:16924821-16924843 AACCACACCCACGTTGCCTTTGG + Intergenic
1138275379 16:55730405-55730427 CACCACCACCACGTTTTCATGGG - Intergenic
1138280623 16:55770035-55770057 CACCACCACCACGTTTTCATGGG - Intergenic
1138287863 16:55823588-55823610 CACCACCACCACGTTTTCATGGG + Exonic
1142314397 16:89334529-89334551 CACCCCACCCATGTGGGCAGTGG + Intronic
1144589548 17:16512602-16512624 CACCACTCCTACATTGGCAGTGG + Intergenic
1146491185 17:33283490-33283512 CACCACACTCCAGTTGGCAATGG - Intronic
1151603920 17:75124423-75124445 CACCACACCCAGGTGCGCCTGGG - Intronic
1151794587 17:76335235-76335257 CACCACACCCAGGCTGGCTGTGG + Intronic
1159915613 18:74185001-74185023 CACCCCACCCAGGTTCTCATGGG - Intergenic
1161777248 19:6270304-6270326 GAGCACAGCCAGGTTGGCATGGG - Intronic
1162147399 19:8621190-8621212 CACCACACCCAGCTGGGGATGGG - Intergenic
1163691580 19:18741533-18741555 CCCCACACCTACCTGGGCATAGG - Intronic
926342117 2:11912193-11912215 AACCACACCCACCTTGTCTTTGG + Intergenic
926723050 2:15976875-15976897 AACCACACCCTCTCTGGCATGGG - Intergenic
936152908 2:110031339-110031361 CACCACACCCACCTTTCCACAGG - Intergenic
936191772 2:110340073-110340095 CACCACACCCACCTTTCCACAGG + Intergenic
938215453 2:129509061-129509083 AACCACACCCACCTTGCCTTTGG - Intergenic
938676849 2:133644494-133644516 CAGTTCACCCACGTTGGAATGGG + Intergenic
939950338 2:148464361-148464383 CACCACACACACGCATGCATGGG + Intronic
941737145 2:168990869-168990891 CACCACCCCTGCTTTGGCATAGG + Exonic
944414315 2:199467764-199467786 CACCACCACCACGTTGGCCTAGG + Intronic
945761409 2:213920406-213920428 ATGCACACACACGTTGGCATGGG + Intronic
946183294 2:217961710-217961732 CACCCAACCCATGTTGACATAGG + Intronic
1170034906 20:11979975-11979997 CACCACACCCTGGTTTCCATGGG - Intergenic
1172324483 20:34023910-34023932 CACCACACCCAGCCTGTCATTGG - Intronic
1174815160 20:53681036-53681058 CACAACACCAACCTTGGCATTGG - Intergenic
1175000446 20:55622604-55622626 CACCACACACAAGTTTGCCTAGG + Intergenic
1175183622 20:57165514-57165536 GACCACAGCCATGCTGGCATGGG + Intergenic
1176178191 20:63738345-63738367 CGCCAGCCCCACGTTGGAATAGG - Exonic
1178710548 21:34912836-34912858 CCCCACACCCTAGTTTGCATCGG - Intronic
1182303917 22:29354820-29354842 CACCACAGCGGAGTTGGCATGGG + Exonic
1184993504 22:48186048-48186070 CTCCACACCCACGATGGATTGGG + Intergenic
950748309 3:15108313-15108335 CAGCAGAACCACGTTGGCTTTGG - Intergenic
952883399 3:37998940-37998962 CACCACCTCCACGTTGGTGTAGG - Exonic
965871081 3:173266084-173266106 CACCTCACCCAGGCTGGCAGAGG - Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
985229168 4:187796634-187796656 CACCACTCCCGCTCTGGCATTGG + Intergenic
987213713 5:15710920-15710942 CACAATTCCCACGTTGTCATGGG + Intronic
987318263 5:16744485-16744507 CACCATAATCCCGTTGGCATGGG - Intronic
996348013 5:122508557-122508579 AACCACCTCCAGGTTGGCATTGG + Intergenic
996542117 5:124641290-124641312 CACCACACCCACGTTGGCATGGG - Exonic
1000197791 5:158976436-158976458 CCCCACCCCCAAGTTGGCCTAGG + Intronic
1000940531 5:167354984-167355006 CACCCCACCTACATTGGCAGGGG - Intronic
1004698130 6:18053068-18053090 AACCACACCCTCCTTGGCATAGG + Intergenic
1006319840 6:33313915-33313937 CCCCACTCCCACCCTGGCATCGG + Intronic
1010781843 6:79953284-79953306 CACCACTGACACGTTGGCAGTGG + Intergenic
1015897447 6:138030980-138031002 CACCTCACCCAGGCTGGCTTTGG - Intergenic
1019579634 7:1754478-1754500 CTCCACACCCTCACTGGCATTGG + Intergenic
1021940680 7:25675997-25676019 CACCACAAACACATTGGTATTGG - Intergenic
1022039327 7:26565296-26565318 CATCATGCCCAGGTTGGCATCGG - Intergenic
1024631970 7:51256492-51256514 GACCACACCCACGTGGGCCTGGG + Intronic
1036648904 8:10629698-10629720 GGCCACTCCCACGCTGGCATGGG + Intronic
1044846214 8:96384587-96384609 CCCCACACCAAAATTGGCATTGG + Intergenic
1059239419 9:112790592-112790614 CACCACACTGACTTTGGCCTTGG - Intronic
1059411405 9:114134658-114134680 CCACACATCCACTTTGGCATGGG + Intergenic
1059443246 9:114322856-114322878 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1059444438 9:114329627-114329649 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1060448642 9:123715962-123715984 CACCACACCCGGGTAGGCACTGG + Intronic
1062423816 9:136497005-136497027 CCCGACACCCACCTGGGCATCGG - Exonic
1189902000 X:45716191-45716213 CCCCACACTCACCTTGGCCTAGG + Intergenic
1191831207 X:65418539-65418561 AACCACACCCACTTTGCCTTTGG - Intronic
1201297806 Y:12479594-12479616 CAGCGCAACCACGTGGGCATGGG - Intergenic