ID: 996549118

View in Genome Browser
Species Human (GRCh38)
Location 5:124711822-124711844
Sequence CCCAGATTCTTAGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 242}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549118_996549127 10 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549118_996549131 30 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data
996549118_996549130 25 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271
996549118_996549124 -5 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549118_996549126 2 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549126 5:124711847-124711869 GTTATTATGAAGTTGGAAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 242
996549118_996549125 1 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549125 5:124711846-124711868 GGTTATTATGAAGTTGGAAGTGG 0: 1
1: 0
2: 0
3: 33
4: 222
996549118_996549129 24 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549129 5:124711869-124711891 GCACTGAGGATTTTAAAGTAGGG No data
996549118_996549128 23 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549128 5:124711868-124711890 GGCACTGAGGATTTTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549118 Original CRISPR CCCAGATTCTTAGCCTGGCC TGG (reversed) Intronic
902698998 1:18158863-18158885 TCCAGATTCTATGCCTGGGCAGG - Intronic
905305576 1:37015622-37015644 CCCAGGTCCATAGCCTAGCCAGG + Intronic
906078781 1:43070071-43070093 CCCAGATGGTTTGCCAGGCCTGG + Intergenic
912491537 1:110065235-110065257 CCCCCATTCTTGGCCTTGCCAGG - Intronic
914256186 1:145962430-145962452 CGCAGAATCTCCGCCTGGCCAGG + Exonic
914947855 1:152081496-152081518 CCCAGGTTCAAAGCCTGGCTGGG - Intergenic
915164257 1:153939812-153939834 CCCTGACTCTTAGGCTGCCCTGG - Intronic
915237189 1:154492512-154492534 CCCAGATACCTGGCCTGGCCTGG - Intronic
916261404 1:162846110-162846132 CCCTGATTCTTGGCCTACCCTGG + Intronic
918198100 1:182241658-182241680 ACCTGATTCTTAGACTGGACTGG - Intergenic
1063044397 10:2377046-2377068 CCCAGTTTCTTAGCAGGGCACGG + Intergenic
1063455922 10:6182685-6182707 CTCTGATTCTTAGCCTGGTGTGG - Intronic
1064167283 10:12997362-12997384 CCCAGAGGCCTAGACTGGCCTGG + Intronic
1065926898 10:30442667-30442689 CGCTGATTCATAACCTGGCCCGG + Intronic
1067415319 10:46097887-46097909 TCCAGTTTCCCAGCCTGGCCTGG + Intergenic
1067435361 10:46272962-46272984 ACCAGTTTCCCAGCCTGGCCTGG + Intergenic
1067582154 10:47452654-47452676 TCCAGCTTCCCAGCCTGGCCTGG + Intergenic
1069788010 10:71001778-71001800 GGAAAATTCTTAGCCTGGCCAGG - Intergenic
1070708757 10:78661510-78661532 CCCAAATACTTAGCATGGACTGG + Intergenic
1073761187 10:106630323-106630345 CACAGATTCTTAGTCTAGTCTGG + Intronic
1075486051 10:122822866-122822888 CCTAGAGGCTTAGCCTGCCCGGG - Intergenic
1075528084 10:123202768-123202790 CCCAGCTTCCCAGCCTGGCAAGG - Intergenic
1078737094 11:14030243-14030265 GCCAGGTTATTAGCCTGCCCAGG + Intronic
1079434980 11:20438618-20438640 CACAGATGCTTAGCTTAGCCAGG + Intronic
1080669606 11:34363825-34363847 CCCAGATTCTGAGACAAGCCTGG - Intergenic
1081278406 11:41178989-41179011 ACCAGATTCTTGGCCGGGCACGG - Intronic
1082036398 11:47648654-47648676 CCCAGATCCTTAGGCAGGACAGG - Intergenic
1082980357 11:59115212-59115234 CCCTACTTCTAAGCCTGGCCAGG - Intronic
1083722670 11:64611188-64611210 CCTAGATACCTAGCCTGGCCTGG - Intronic
1083913921 11:65727781-65727803 TGCAGACTCTTAGCCTTGCCTGG - Intergenic
1084314971 11:68340352-68340374 CCTGGATTCAAAGCCTGGCCTGG - Intronic
1084489001 11:69468038-69468060 CCCAGATTCTCATTCTGCCCTGG + Intergenic
1089587604 11:119520258-119520280 CCCAGAGTCTCAGGCTGCCCTGG + Intergenic
1096799913 12:54103622-54103644 CCCACCCCCTTAGCCTGGCCTGG + Intergenic
1097289129 12:57899127-57899149 CCCCACTTCTCAGCCTGGCCTGG - Intergenic
1101236573 12:102795857-102795879 GGCTGAATCTTAGCCTGGCCTGG + Intergenic
1101599775 12:106198979-106199001 CAAAGATTCTTAGCCTGGTGTGG + Intergenic
1102020680 12:109680144-109680166 CCCAGACCCTTAGCCTGATCTGG + Intergenic
1102543758 12:113640074-113640096 CCCAGACTCTGGGCCTGGCTGGG + Intergenic
1105265113 13:18808744-18808766 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1105298439 13:19111778-19111800 GCCAGATTATTGGCCTGGGCAGG - Intergenic
1105482931 13:20795719-20795741 CACAGATACTTAGCCAGGACTGG - Intronic
1106174420 13:27317434-27317456 CCCAGCTACTTAGCCTGGGGTGG + Intergenic
1114059495 14:19006611-19006633 CCCAAATTCTAAGTCTGGCCAGG - Intergenic
1114059595 14:19007249-19007271 CACAAATTCTCAGTCTGGCCAGG - Intergenic
1114060513 14:19012793-19012815 CACAAATTCTAAGTCTGGCCAGG - Intergenic
1114101742 14:19387185-19387207 CACAAATTCTAAGTCTGGCCAGG + Intergenic
1114102951 14:19394502-19394524 CACAAATTCTCAGTCTGGCCAGG + Intergenic
1114103051 14:19395140-19395162 CCCAAATTCTAAGTCTGGCCAGG + Intergenic
1118703751 14:68460790-68460812 CCAAGATTCTTGGCTTGGCCAGG - Intronic
1119390212 14:74286638-74286660 CCCAAAGGCTCAGCCTGGCCAGG - Intronic
1121420273 14:93808208-93808230 CCCAGATGCTCAGCCAGTCCTGG - Intergenic
1121741230 14:96253744-96253766 CCCAGATGCTGAGCCTCTCCAGG - Intronic
1122040474 14:98984243-98984265 CCCAGTCTCTTCTCCTGGCCTGG + Intergenic
1202833363 14_GL000009v2_random:59377-59399 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1202836974 14_GL000009v2_random:85624-85646 GCCAAATTCTAAGTCTGGCCGGG - Intergenic
1123496084 15:20828357-20828379 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123552569 15:21397449-21397471 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123552677 15:21398093-21398115 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1123553208 15:21401284-21401306 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1123553318 15:21401923-21401945 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123588815 15:21834837-21834859 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123588923 15:21835481-21835503 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1123589138 15:21836762-21836784 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123589453 15:21838672-21838694 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1123589563 15:21839311-21839333 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1123629447 15:22251059-22251081 CCAAAACCCTTAGCCTGGCCAGG + Intergenic
1123880487 15:24674802-24674824 CCCAGGTTCGAAGCCTGGCTAGG + Intergenic
1125608608 15:40956319-40956341 CACAGCTGCTGAGCCTGGCCTGG + Exonic
1126795532 15:52257890-52257912 TCCAGGTTCTTACCCTGCCCAGG - Intronic
1129236703 15:74228072-74228094 CCCTGATTCTATGCCAGGCCTGG + Intergenic
1130546416 15:84859921-84859943 CCCGGGGTCTCAGCCTGGCCTGG + Intronic
1131159175 15:90093236-90093258 CCCGGAGTCTGAGCCTGGCTTGG - Intronic
1202960918 15_KI270727v1_random:124669-124691 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1202961027 15_KI270727v1_random:125313-125335 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1202961241 15_KI270727v1_random:126594-126616 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1202961556 15_KI270727v1_random:128504-128526 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1202961666 15_KI270727v1_random:129143-129165 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1132849569 16:2018938-2018960 CCCAGATCCTTGGCCGGGCGCGG - Intronic
1133229657 16:4360531-4360553 CCCAGATCTTCAGCCTGGCCTGG - Exonic
1133719794 16:8484189-8484211 CCCAGATCCTTATATTGGCCAGG - Intergenic
1135394901 16:22123666-22123688 CCCAGATTCTTCTGCTGGCCAGG - Exonic
1138262501 16:55635250-55635272 CCCTGATTCTTCCTCTGGCCTGG - Intergenic
1138829705 16:60360376-60360398 CCCAGGTTCAAAGCCTGGCTGGG - Intergenic
1139512509 16:67435619-67435641 ACCAGAGTCACAGCCTGGCCAGG - Exonic
1139834797 16:69829649-69829671 GCCAGATGCTTGGCCTGGTCAGG - Intronic
1139845087 16:69915125-69915147 CCCAGATTCTCAGACGGGACAGG - Intronic
1141667637 16:85474180-85474202 CCCAGGTCCCTGGCCTGGCCTGG - Intergenic
1141932717 16:87216758-87216780 CTCTGCTTCTCAGCCTGGCCTGG - Intronic
1141974110 16:87503377-87503399 CCAAAACCCTTAGCCTGGCCAGG - Intergenic
1143119672 17:4598979-4599001 CTCTGATTCTTTCCCTGGCCAGG - Intronic
1146526693 17:33572816-33572838 CCCTGCTCCATAGCCTGGCCTGG + Intronic
1146934992 17:36807897-36807919 CCCAGAGTCTCAGCCGGCCCAGG - Intergenic
1147911830 17:43860568-43860590 CCCATATTCTGACCCGGGCCTGG - Intronic
1147968300 17:44206054-44206076 CCCAGGTTCTGAGCCTGGGGTGG + Exonic
1148447188 17:47744878-47744900 ACCACATCCTTCGCCTGGCCAGG - Exonic
1151843479 17:76634434-76634456 CCCACATTGTTAGCTGGGCCTGG + Intronic
1152560669 17:81077274-81077296 CCCAATTTCTTAGCCGGGCATGG + Intronic
1152814701 17:82400326-82400348 CCCAGAATCAGAGCCTGGCATGG - Intronic
1153975632 18:10266393-10266415 CCAAGATTTTGAGACTGGCCAGG + Intergenic
1154423280 18:14252800-14252822 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1154453484 18:14500849-14500871 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1154453593 18:14501490-14501512 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1154453894 18:14503401-14503423 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1154454002 18:14504040-14504062 ACCAAATTCTAAGCCTGGCCCGG + Intergenic
1158247329 18:55446687-55446709 CCAAAAATCTTAGCCAGGCCAGG + Intronic
1159142377 18:64413430-64413452 GCCAGATTCTCAGCCGGGCGCGG + Intergenic
1162340013 19:10086556-10086578 CCCAGATCCTTACCCCTGCCTGG + Intronic
1163385445 19:16997248-16997270 CCCAGATGCTGACCCTGCCCCGG + Exonic
1164846556 19:31437780-31437802 CACAGAGGCTGAGCCTGGCCAGG - Intergenic
1165068820 19:33243522-33243544 CCCAAATACTTAGCCAGGCATGG + Intergenic
1165092657 19:33395008-33395030 CCCAGGTTCTCAGCTTGGCCTGG + Intronic
1166008773 19:39925930-39925952 GCCAGAGTCTTAGCGTGGCAGGG + Intronic
1166075815 19:40413288-40413310 CACAGTGTCTCAGCCTGGCCAGG + Intronic
1202635664 1_KI270706v1_random:41726-41748 GCCAAATTCTAAGTCTGGCCGGG + Intergenic
1202639307 1_KI270706v1_random:68318-68340 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
926053054 2:9757002-9757024 CCCAGCTTCTGCTCCTGGCCGGG - Intergenic
928099521 2:28427887-28427909 CTCAGATTCTGGGGCTGGCCGGG + Intergenic
931638532 2:64361857-64361879 CCCAGAGTCTCAGGCTGGCATGG - Intergenic
932769999 2:74495588-74495610 CCCAGTACCTTAGCCTGCCCTGG + Intergenic
932803705 2:74765433-74765455 CCCAGACTCCTAGCCTGACATGG + Intergenic
934494769 2:94787782-94787804 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
937118932 2:119428842-119428864 CCCTGCTTCTAGGCCTGGCCAGG - Intergenic
938280301 2:130059341-130059363 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938280714 2:130061865-130061887 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938280821 2:130062496-130062518 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938281017 2:130063669-130063691 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938331254 2:130450055-130450077 CACAAATTCTAAGTCTGGCCAGG + Intergenic
938331360 2:130450695-130450717 CACAAATTCTAAGTCTGGCCAGG + Intergenic
938331660 2:130452504-130452526 CACAAATTCTAAGTCTGGCCAGG + Intergenic
938331873 2:130453782-130453804 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938332204 2:130455772-130455794 CACAAATTCTGAGTCTGGCCAGG + Intergenic
938357605 2:130664896-130664918 CACAAATTCTGAGTCTGGCCAGG - Intergenic
938358136 2:130668057-130668079 CACAAATTCTGAGTCTGGCCAGG - Intergenic
938358591 2:130670808-130670830 CACAAATTCTAAGTCTGGCCAGG - Intergenic
938358699 2:130671448-130671470 CACAAATTCTAAGTCTGGCCAGG - Intergenic
938434357 2:131273670-131273692 CACAAATTCTGAGTCTGGCCAGG - Intronic
938434679 2:131275660-131275682 CACAAATTCTGAGTCTGGCCAGG - Intronic
938434877 2:131276836-131276858 CACAAATTCTGAGTCTGGCCAGG - Intronic
938434980 2:131277474-131277496 CACAAATTCTGAGTCTGGCCAGG - Intronic
938478296 2:131635664-131635686 CACAAATTCTAAGTCTGGCCAGG - Intergenic
938478407 2:131636302-131636324 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
938642305 2:133293773-133293795 GCCAGACTCTTATCCTGGCAGGG + Intronic
939881951 2:147641027-147641049 CACTGATTCTTAGCATGGTCTGG - Intergenic
942460065 2:176162516-176162538 CCCAGATTCTCAGCCTTAACCGG - Intronic
944368154 2:198948971-198948993 CCCAGAATCTTAGCCTCCGCTGG + Intergenic
944535014 2:200700334-200700356 CCCAGGTTCTAACCATGGCCTGG - Intergenic
948884107 2:240874465-240874487 TCCAGATTCTGAGCCAGGCCGGG + Intronic
1170824671 20:19783503-19783525 CCCAGAGCCTTTGCCTGGACAGG - Intergenic
1171310678 20:24142371-24142393 CCCAGGTTCTTTGCCTGTCAGGG + Intergenic
1174545517 20:51322363-51322385 CCCAGATCCTTCCTCTGGCCAGG + Intergenic
1174976287 20:55339208-55339230 CCTAAATTATTAGCCTAGCCAGG - Intergenic
1175286022 20:57837402-57837424 TCCACATTCAGAGCCTGGCCGGG - Intergenic
1175890682 20:62314596-62314618 CCCAGAGCCTGAGCCTGGGCAGG - Exonic
1176647631 21:9365927-9365949 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1176820169 21:13649256-13649278 ACCAAATTCTAAGTCTGGCCAGG - Intergenic
1176820276 21:13649895-13649917 CCCAAATTCTAAGTCTGGTCAGG - Intergenic
1176820588 21:13651815-13651837 CCCAAATTCTAAGTCTGGTCAGG - Intergenic
1176820698 21:13652456-13652478 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1176850195 21:13907209-13907231 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1180362640 22:11913546-11913568 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1180365049 22:11931500-11931522 GCCAAATTCTAAGTCTGGCCGGG - Intergenic
1180477975 22:15729226-15729248 CCCAAATTCTAAGTCTGGCCAGG - Intergenic
1180478075 22:15729861-15729883 CACAAATTCTCAGTCTGGCCAGG - Intergenic
1180478995 22:15735405-15735427 CACAAATTCTAAGTCTGGCCAGG - Intergenic
1180634123 22:17250828-17250850 CCCAGAATCTGAGCCTGAGCCGG + Intergenic
1181696417 22:24594966-24594988 CCCAGAGGCTGAGCCAGGCCTGG + Intronic
1182000647 22:26916887-26916909 CCCAGATTCTTAAATTAGCCTGG - Intergenic
1184939326 22:47749606-47749628 CTCAGATTTGTAGCCTGCCCTGG + Intergenic
1185031008 22:48442916-48442938 CCCTCATCCTCAGCCTGGCCTGG - Intergenic
1185127951 22:49022238-49022260 CCCAGGCTCTGAGCCTGTCCAGG + Intergenic
950443267 3:13022156-13022178 CCCAGAGTCTCCTCCTGGCCAGG + Intronic
950462678 3:13134840-13134862 CCCAGGTTCTGAGGCTGGACTGG - Intergenic
950869518 3:16216658-16216680 CCCTGATTCTTCCCCTGGCGGGG + Intronic
957986512 3:87578976-87578998 TCCAGATGCTTAGATTGGCCTGG - Intergenic
958420809 3:93928376-93928398 GCCATAGTCTTAGCCAGGCCTGG + Intronic
959348038 3:105224030-105224052 CCCTGTCTCTTAGCCAGGCCTGG - Intergenic
959638880 3:108608901-108608923 CACAGTTTCTTAGGCTGGACAGG + Intronic
959932883 3:112002094-112002116 GCAAGATCCATAGCCTGGCCTGG - Intronic
962240591 3:133747882-133747904 CCCAGATTCTAGGCCTGGCTTGG + Intronic
966139667 3:176741525-176741547 CAAAGATTATTAGCCTGGCATGG - Intergenic
968283686 3:197495778-197495800 CCCACTTTCCTAGGCTGGCCGGG + Intergenic
1202739247 3_GL000221v1_random:39060-39082 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
972814862 4:42632879-42632901 GTCAGATTATTAGCCTAGCCTGG - Intronic
973369547 4:49234678-49234700 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
973391485 4:49560738-49560760 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
976189317 4:82473835-82473857 CCCAGGCACTTAGCCTGGTCAGG - Intergenic
981856244 4:149296581-149296603 ATGAGATTCTTGGCCTGGCCAGG + Intergenic
982669119 4:158298981-158299003 CACAGATTTTTTGCCTGGGCCGG - Intergenic
982721096 4:158860942-158860964 CCCAGATTCTCAGCCGGGCGTGG - Intronic
1202762986 4_GL000008v2_random:127606-127628 GCCAAATTCTAAGTCTGGCCGGG + Intergenic
1202766661 4_GL000008v2_random:154188-154210 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
987413885 5:17642777-17642799 CCAAGATTCCTGGCCTGGACAGG + Intergenic
988517056 5:31914234-31914256 TCAAGATTCTGATCCTGGCCGGG + Intronic
991299532 5:65115643-65115665 CTCACATGCTCAGCCTGGCCAGG - Intergenic
991701708 5:69322431-69322453 CTCAAATTCTTAGCCAGGCATGG + Intronic
992156353 5:73958762-73958784 GCCAAATTCTTTGGCTGGCCAGG - Intergenic
993881419 5:93366371-93366393 CCCAGCCTCTTCCCCTGGCCTGG + Intergenic
993884547 5:93400242-93400264 TCCAGACTCTTATCCAGGCCTGG + Intergenic
996549118 5:124711822-124711844 CCCAGATTCTTAGCCTGGCCTGG - Intronic
997266580 5:132498317-132498339 CCCTGATCCTAAGCCTGGGCTGG - Intergenic
1001415351 5:171541675-171541697 ACCGGATCCTTAGCCTGGCCAGG + Intergenic
1002361131 5:178671873-178671895 CTGAGAATCTAAGCCTGGCCTGG + Intergenic
1002617166 5:180463146-180463168 CCAAGATCCTTAGCTTCGCCAGG - Intergenic
1003249938 6:4418196-4418218 CCAAGATTCTTGGCCGGGCACGG + Intergenic
1003565004 6:7215278-7215300 CCCAGATTCTCTTGCTGGCCGGG - Intronic
1005038681 6:21581676-21581698 CTCTGATTCTTGGCCAGGCCCGG + Intergenic
1005834140 6:29695196-29695218 CCCAGCTTCATGACCTGGCCAGG + Intergenic
1006938082 6:37732380-37732402 CCCAGGCTCTTGTCCTGGCCTGG - Intergenic
1007995671 6:46305278-46305300 CCCATTTTCTTACCCTGGACAGG + Intronic
1008799445 6:55348537-55348559 CCCAGAATCTTTTCCTGGCTAGG + Intronic
1016243746 6:141959827-141959849 AGCACATTCTTAGCTTGGCCAGG - Intergenic
1016661359 6:146584820-146584842 CCCAGAGTTTGAGACTGGCCTGG + Intergenic
1017772568 6:157654292-157654314 CCAGGAATCTCAGCCTGGCCTGG + Intronic
1017778665 6:157699540-157699562 ACCAGATTCTTAACCTCTCCTGG + Intergenic
1018804556 6:167248778-167248800 CCCAGGTTCTTAGTCAGGGCAGG + Intergenic
1020560746 7:9727140-9727162 CCCAGATGCTGACCCTGCCCCGG - Intergenic
1021852009 7:24817547-24817569 ACCAGACTCTTAGCCAGGCTTGG - Intronic
1024262702 7:47583695-47583717 CCCACTTTCTTCGCCTGACCAGG - Intergenic
1026151547 7:67791932-67791954 AGCATATTCTAAGCCTGGCCAGG - Intergenic
1026446743 7:70491284-70491306 ACCAGATTCTGATCCTGGGCAGG + Intronic
1026663664 7:72323832-72323854 CCAAGATTTTGAGACTGGCCTGG + Intronic
1027236087 7:76298766-76298788 CCCCGATTCTGGGCCTGGGCAGG + Intergenic
1029791239 7:102845183-102845205 CCAAGATTCTAATCGTGGCCTGG + Intronic
1030822949 7:114117709-114117731 CCCAGTGTCTTAGCTTGGGCTGG + Intronic
1034226922 7:149491422-149491444 CCCAGCTTCCTAGCCTGGGTGGG - Intronic
1034242061 7:149618181-149618203 TCCAGCTTCTTAGCCTGGGTGGG - Intergenic
1034335037 7:150316772-150316794 ACCAGATTCTTGGCCAGGCGTGG - Intronic
1035386678 7:158477770-158477792 CCCAGGTTTTCAGCCTGGCCTGG + Intronic
1040101892 8:43513095-43513117 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1041477633 8:58283414-58283436 GCCAGAATCTCAGCCTGGCCTGG - Intergenic
1048601679 8:135924936-135924958 CCAAGATTCTTACCCAGGTCCGG - Intergenic
1049012392 8:139895928-139895950 CAGAGCTTCTCAGCCTGGCCGGG - Intronic
1049999145 9:1057904-1057926 CCCAGTTTCTTTCCCTGGCGAGG + Intergenic
1050148545 9:2596345-2596367 CCTAAATTCTCAGCCTGGCATGG - Intergenic
1052978118 9:34426966-34426988 CCATCATTCTTAGCCTGGTCTGG - Intronic
1053912801 9:42922744-42922766 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1054374477 9:64438806-64438828 GCCAAATTCTAAGTCTGGCCAGG - Intergenic
1056932979 9:90893896-90893918 CCCAGCTTCCTGGCCTGCCCTGG - Intronic
1056988470 9:91387701-91387723 CCCAGGGACTGAGCCTGGCCAGG - Intergenic
1057071329 9:92103497-92103519 CCCAGGTTCAAAGCCTGGCTGGG + Intronic
1057195402 9:93113570-93113592 CCCAGCTGCTGAGCCTGGACCGG + Intergenic
1057975827 9:99605164-99605186 CTGGGATTCTTAGCCTGGCTGGG - Intergenic
1058271801 9:102981718-102981740 CCCAAAGTCTTAACTTGGCCTGG - Intergenic
1059759499 9:117324781-117324803 TCCAGATCCTTAGCATGGCCTGG - Intronic
1060890435 9:127184576-127184598 ACCGGATTCTCAGCCTGGGCAGG + Intronic
1062006017 9:134238908-134238930 ACCAGATTCTTAGCCGGGCATGG - Intergenic
1203526658 Un_GL000213v1:97109-97131 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1203526871 Un_GL000213v1:98387-98409 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1203527083 Un_GL000213v1:99656-99678 CCCAAATTCTAAGTCTGGTCAGG + Intergenic
1203527191 Un_GL000213v1:100295-100317 ACCAAATTCTAAGTCTGGCCAGG + Intergenic
1203543749 Un_KI270743v1:112487-112509 GCCAAATTCTAAGTCTGGCCGGG + Intergenic
1203547414 Un_KI270743v1:139066-139088 GCCAAATTCTAAGTCTGGCCAGG + Intergenic
1187686619 X:21821884-21821906 CCCAGATTCAGGGGCTGGCCTGG - Intergenic
1188294951 X:28435849-28435871 CCCATATTCTTTGGCTGCCCGGG + Intergenic
1189831021 X:44973154-44973176 CCCAGATTCTTAACTGGGCTTGG - Intronic
1192095022 X:68201558-68201580 GCCAGATGCTTAGCCTGGGTAGG - Intronic
1192360956 X:70439183-70439205 CCCAGATTTTCACTCTGGCCAGG + Intergenic
1197546715 X:127834324-127834346 CTCAGATTCTTAGACTGGTTGGG + Intergenic
1199844109 X:151678520-151678542 TCCAGATTCTCCACCTGGCCTGG + Intergenic
1200171751 X:154081398-154081420 CCCAGATTTTTAGCTGGGCATGG - Intronic