ID: 996549118

View in Genome Browser
Species Human (GRCh38)
Location 5:124711822-124711844
Sequence CCCAGATTCTTAGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549118_996549127 10 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549118_996549129 24 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549129 5:124711869-124711891 GCACTGAGGATTTTAAAGTAGGG No data
996549118_996549124 -5 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549118_996549131 30 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data
996549118_996549125 1 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549125 5:124711846-124711868 GGTTATTATGAAGTTGGAAGTGG 0: 1
1: 0
2: 0
3: 33
4: 222
996549118_996549128 23 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549128 5:124711868-124711890 GGCACTGAGGATTTTAAAGTAGG No data
996549118_996549126 2 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549126 5:124711847-124711869 GTTATTATGAAGTTGGAAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 242
996549118_996549130 25 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549118 Original CRISPR CCCAGATTCTTAGCCTGGCC TGG (reversed) Intronic