ID: 996549123

View in Genome Browser
Species Human (GRCh38)
Location 5:124711827-124711849
Sequence AACCCCCCAGATTCTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549123_996549126 -3 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549126 5:124711847-124711869 GTTATTATGAAGTTGGAAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 242
996549123_996549128 18 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549128 5:124711868-124711890 GGCACTGAGGATTTTAAAGTAGG No data
996549123_996549130 20 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271
996549123_996549129 19 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549129 5:124711869-124711891 GCACTGAGGATTTTAAAGTAGGG No data
996549123_996549125 -4 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549125 5:124711846-124711868 GGTTATTATGAAGTTGGAAGTGG 0: 1
1: 0
2: 0
3: 33
4: 222
996549123_996549131 25 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data
996549123_996549127 5 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549123_996549124 -10 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549123_996549132 29 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549132 5:124711879-124711901 TTTTAAAGTAGGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549123 Original CRISPR AACCCCCCAGATTCTTAGCC TGG (reversed) Intronic