ID: 996549123

View in Genome Browser
Species Human (GRCh38)
Location 5:124711827-124711849
Sequence AACCCCCCAGATTCTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549123_996549124 -10 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549123_996549127 5 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549123_996549125 -4 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549125 5:124711846-124711868 GGTTATTATGAAGTTGGAAGTGG 0: 1
1: 0
2: 0
3: 33
4: 222
996549123_996549126 -3 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549126 5:124711847-124711869 GTTATTATGAAGTTGGAAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 242
996549123_996549129 19 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549129 5:124711869-124711891 GCACTGAGGATTTTAAAGTAGGG No data
996549123_996549130 20 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271
996549123_996549128 18 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549128 5:124711868-124711890 GGCACTGAGGATTTTAAAGTAGG No data
996549123_996549132 29 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549132 5:124711879-124711901 TTTTAAAGTAGGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 110
996549123_996549131 25 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549123 Original CRISPR AACCCCCCAGATTCTTAGCC TGG (reversed) Intronic
904995280 1:34626677-34626699 AATCCCCCAGATTCTGAGAATGG - Intergenic
906117096 1:43364270-43364292 ATCCCCCCACATTCCTAGCCTGG - Intronic
915891027 1:159774170-159774192 AACCCCCAAGATTTATAGACTGG - Intergenic
920739451 1:208566637-208566659 AAGCTACCAGATTCTCAGCCAGG + Intergenic
920856652 1:209668190-209668212 AATGCCCCAGATTCTTTGCATGG - Intergenic
922604931 1:226884050-226884072 AACCGCCCAGGTTCATGGCCTGG + Intronic
922894272 1:229088364-229088386 AGCCCCACAGGTGCTTAGCCAGG - Intergenic
1063881734 10:10538601-10538623 AACCCACCCTATTCTTAGCATGG + Intergenic
1063998357 10:11641996-11642018 AAACCCCTAAATTCTTAGCTTGG - Intergenic
1064674161 10:17744915-17744937 AACCACCCAGATTCTTTACTTGG - Intergenic
1080525951 11:33118208-33118230 ATCCTCTCAAATTCTTAGCCAGG + Intronic
1085635575 11:78156919-78156941 AACTCCCTTGATTCTTTGCCTGG - Intergenic
1089156789 11:116408899-116408921 AACCCCAAAGAAACTTAGCCAGG - Intergenic
1092123833 12:6062519-6062541 AAACCACCAGATTCTTCCCCTGG - Intronic
1095616254 12:44193020-44193042 AACCCTACAGATTCTAAGTCTGG - Intronic
1096889422 12:54752673-54752695 AATCTCCCACATTCTTAGGCAGG - Intergenic
1100734793 12:97514456-97514478 AATCCCCCCAATTTTTAGCCAGG + Intergenic
1103350851 12:120282540-120282562 AATCCAGCAGATTCTAAGCCAGG + Intergenic
1103392775 12:120586224-120586246 AACCCTCCATCTGCTTAGCCAGG + Intergenic
1104704646 12:130934020-130934042 CACTCCCCAGATTCTGCGCCTGG + Intergenic
1108723313 13:53154293-53154315 AACCCCAAAGAATCTTAGCTAGG + Intergenic
1111774082 13:92637092-92637114 GACCCCCAAAATTCTTAGTCTGG + Intronic
1121083636 14:91128326-91128348 AACCCACAAGAATATTAGCCGGG + Intronic
1137789414 16:51162416-51162438 AACCTCCAAGAGTCTAAGCCAGG + Intergenic
1141369217 16:83471761-83471783 AAATACCCAGCTTCTTAGCCAGG + Intronic
1145247167 17:21276862-21276884 GGCCCCCCAGATACATAGCCTGG - Intergenic
1148073005 17:44919607-44919629 AACCCCCCATCCTCCTAGCCTGG + Intergenic
1148556806 17:48583416-48583438 AATCCACCAGATTCTAATCCTGG - Intronic
1148642758 17:49200709-49200731 AACTCCCCACCTTCCTAGCCCGG - Intergenic
1151724464 17:75876294-75876316 AGCCCGCCAGAATCTCAGCCAGG - Exonic
1153215702 18:2818938-2818960 AACACCCCATATTCTTAGGTAGG + Intergenic
1154391615 18:13941429-13941451 AAGCCCCCAGCTTCTCATCCAGG + Intergenic
1155008960 18:21756051-21756073 TACCCCCCAGTTTCTTTGCAGGG + Intronic
1155991868 18:32286542-32286564 AAACTCCTAGATTTTTAGCCTGG - Intronic
1156993249 18:43435702-43435724 AAACCCCCACATTTATAGCCAGG - Intergenic
1161355338 19:3816194-3816216 AACCAACCAGTTTGTTAGCCAGG - Intronic
1162468180 19:10855493-10855515 AACCCCACAAATAATTAGCCAGG - Intronic
1164954360 19:32368969-32368991 AACCCCCCACTTTCCTGGCCTGG - Intronic
1165068814 19:33243517-33243539 ACCCCCCCAAATACTTAGCCAGG + Intergenic
925140285 2:1545507-1545529 AACTCCCTGGATACTTAGCCAGG - Intergenic
925558160 2:5154539-5154561 AATCTCCCAGAGTCTTGGCCAGG - Intergenic
935403160 2:102681391-102681413 AACTGCCCAGATTCATACCCTGG + Intronic
937806270 2:126149385-126149407 TACCACTCAGTTTCTTAGCCAGG - Intergenic
937922312 2:127139074-127139096 AATCACCCAGATTCTTTCCCTGG + Intergenic
940302478 2:152189740-152189762 AAGCCCATAGATCCTTAGCCAGG + Intergenic
947589107 2:231374900-231374922 GATCCCCCAGATTCTAGGCCAGG - Intergenic
947645106 2:231733142-231733164 ACCCACCCAGAGTCTTAGCTTGG + Intronic
948978936 2:241482798-241482820 AGCCCCTCAGATTCCTAACCTGG - Intronic
1172771972 20:37387136-37387158 AACCCCCAACTTCCTTAGCCAGG - Intronic
1173732644 20:45339306-45339328 AACAGACCACATTCTTAGCCAGG - Intronic
1181822092 22:25484345-25484367 AACTCCCCAGATACTTAGAGTGG + Intergenic
1182529380 22:30943625-30943647 AACCCCTGAGGTGCTTAGCCTGG - Intronic
1183214205 22:36468564-36468586 ACCCCCCCAAAATATTAGCCAGG + Intronic
949870793 3:8586556-8586578 AACCTGCCATATTCTTGGCCTGG - Intergenic
951168780 3:19513414-19513436 TACTCCACAGATTCCTAGCCTGG + Intronic
961022510 3:123520864-123520886 AACCACACAGGCTCTTAGCCTGG + Intronic
961325614 3:126107594-126107616 AACCACCTAGATTCTTTGGCAGG + Intronic
966911825 3:184564091-184564113 AGCCCCCCAGCTGCTTGGCCTGG - Intronic
971877499 4:32324841-32324863 AACCCCCAGGATTCTGATCCTGG + Intergenic
973760698 4:54112570-54112592 AACCTCCCAGATCCTTAGGGAGG + Intronic
979809364 4:125016170-125016192 ATTCCCCCAGATTCTTTGCCAGG - Intergenic
985690785 5:1311070-1311092 AACCCCCAAGATTCTGTACCTGG - Intergenic
985713301 5:1442285-1442307 TTCCCCCCAGATTCTTCCCCAGG + Intronic
992101736 5:73414566-73414588 AACCCCCCTAATTTTTAGCTGGG - Intergenic
996549123 5:124711827-124711849 AACCCCCCAGATTCTTAGCCTGG - Intronic
1001103572 5:168834113-168834135 AACCCCACAGAAGCTGAGCCAGG - Intronic
1001820068 5:174703478-174703500 AACCCCCCAGATCCCTAGCTTGG - Intergenic
1003249936 6:4418191-4418213 AATCACCAAGATTCTTGGCCGGG + Intergenic
1004466595 6:15891271-15891293 ATCCCCCCAGTTTCCTCGCCAGG - Intergenic
1006956049 6:37873108-37873130 AACCCCCCAAAAAATTAGCCAGG + Intronic
1007284094 6:40735492-40735514 AACCCCCCAGAGTCCTAGAGGGG + Intergenic
1007929270 6:45676000-45676022 AGCTGCCCAGATTCTTGGCCTGG + Intergenic
1011898216 6:92258971-92258993 AACCCCACTGATTCTTTCCCTGG - Intergenic
1013615914 6:111842798-111842820 AACCTCCTAGATTCTTAGTGTGG - Intronic
1020792892 7:12648028-12648050 AACCCCCCTGATCCTTACGCAGG - Intronic
1021021470 7:15603437-15603459 AAACCCCAAGATTCTTACCTGGG - Intergenic
1029010245 7:97252595-97252617 AACCTCTCAGATTTTTGGCCTGG - Intergenic
1030286639 7:107833570-107833592 AACTCCCCAGTTTATTGGCCTGG - Intergenic
1030543904 7:110868466-110868488 AACCCCCCAGCCTCTGGGCCTGG - Intronic
1031644034 7:124201720-124201742 GTCCCCTCTGATTCTTAGCCAGG - Intergenic
1040834469 8:51717889-51717911 AACCCCCCTTATAATTAGCCAGG - Intronic
1042174242 8:66023187-66023209 AAGCCCCCTCACTCTTAGCCTGG + Intronic
1055719702 9:79158027-79158049 AAAAGCCCAGCTTCTTAGCCTGG - Intergenic
1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG + Intergenic
1062006018 9:134238913-134238935 AAGAGACCAGATTCTTAGCCGGG - Intergenic
1189899852 X:45695211-45695233 AAGCCCCCACATTCTGAGCGTGG + Intergenic
1198960102 X:142174599-142174621 AACCTCACAGCTTCTTAGACAGG + Intergenic
1199137514 X:144270554-144270576 CACCACCCAGATACTAAGCCTGG - Intergenic
1201534187 Y:15027715-15027737 AACCACCCAGATTGATAGACTGG + Intergenic