ID: 996549124

View in Genome Browser
Species Human (GRCh38)
Location 5:124711840-124711862
Sequence CTGGGGGGTTATTATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549118_996549124 -5 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG 0: 1
1: 0
2: 0
3: 18
4: 242
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549123_996549124 -10 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data
996549116_996549124 -4 Left 996549116 5:124711821-124711843 CCCAGGCCAGGCTAAGAATCTGG 0: 1
1: 0
2: 2
3: 16
4: 210
Right 996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549124 Original CRISPR CTGGGGGGTTATTATGAAGT TGG Intronic
No off target data available for this crispr