ID: 996549127

View in Genome Browser
Species Human (GRCh38)
Location 5:124711855-124711877
Sequence GAAGTTGGAAGTGGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549118_996549127 10 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549116_996549127 11 Left 996549116 5:124711821-124711843 CCCAGGCCAGGCTAAGAATCTGG No data
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360
996549123_996549127 5 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549127 5:124711855-124711877 GAAGTTGGAAGTGGGCACTGAGG 0: 1
1: 0
2: 0
3: 28
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549127 Original CRISPR GAAGTTGGAAGTGGGCACTG AGG Intronic