ID: 996549130

View in Genome Browser
Species Human (GRCh38)
Location 5:124711870-124711892
Sequence CACTGAGGATTTTAAAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549118_996549130 25 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271
996549116_996549130 26 Left 996549116 5:124711821-124711843 CCCAGGCCAGGCTAAGAATCTGG No data
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271
996549123_996549130 20 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549130 5:124711870-124711892 CACTGAGGATTTTAAAGTAGGGG 0: 1
1: 0
2: 3
3: 34
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549130 Original CRISPR CACTGAGGATTTTAAAGTAG GGG Intronic