ID: 996549131

View in Genome Browser
Species Human (GRCh38)
Location 5:124711875-124711897
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549123_996549131 25 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data
996549118_996549131 30 Left 996549118 5:124711822-124711844 CCAGGCCAGGCTAAGAATCTGGG No data
Right 996549131 5:124711875-124711897 AGGATTTTAAAGTAGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type