ID: 996549132

View in Genome Browser
Species Human (GRCh38)
Location 5:124711879-124711901
Sequence TTTTAAAGTAGGGGCACGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996549123_996549132 29 Left 996549123 5:124711827-124711849 CCAGGCTAAGAATCTGGGGGGTT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 996549132 5:124711879-124711901 TTTTAAAGTAGGGGCACGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996549132 Original CRISPR TTTTAAAGTAGGGGCACGGA AGG Intronic