ID: 996551273

View in Genome Browser
Species Human (GRCh38)
Location 5:124732942-124732964
Sequence CTGTATAGAGGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996551273_996551278 -5 Left 996551273 5:124732942-124732964 CCTTCTTCCCTCCCTCTATACAG 0: 1
1: 0
2: 2
3: 42
4: 591
Right 996551278 5:124732960-124732982 TACAGCTTAAAAGATGCACTTGG 0: 1
1: 0
2: 1
3: 21
4: 219
996551273_996551279 0 Left 996551273 5:124732942-124732964 CCTTCTTCCCTCCCTCTATACAG 0: 1
1: 0
2: 2
3: 42
4: 591
Right 996551279 5:124732965-124732987 CTTAAAAGATGCACTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996551273 Original CRISPR CTGTATAGAGGGAGGGAAGA AGG (reversed) Intronic
900291516 1:1925636-1925658 CTGTGTAGAGGAGGGGTAGAGGG + Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
900993265 1:6107488-6107510 ATGGATAGATGGAGGGACGATGG + Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901914588 1:12488223-12488245 CTGAATAAAGGTAGGAAAGAGGG + Intronic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904580543 1:31540509-31540531 GTATGTAGAGGGAGGGTAGATGG + Intergenic
904676545 1:32202150-32202172 CTGTAGAGAGGAAGGCAAGGGGG + Intronic
904865357 1:33574666-33574688 CTGTTCAGAGGGAGAGAAGTTGG + Intronic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
905245540 1:36610653-36610675 CTGGGCAGAGGGAGGGAAAAAGG + Intergenic
905393974 1:37655666-37655688 GGGTTTTGAGGGAGGGAAGAGGG - Intergenic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906297497 1:44658201-44658223 GTGTGTAGAGGGACAGAAGAGGG - Intronic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
907848924 1:58235569-58235591 ATATATAGAGGGAGGGGTGAAGG + Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909251922 1:73368822-73368844 ATGTAGAGAGGCAGAGAAGAAGG - Intergenic
909867899 1:80697255-80697277 CTGCAGAGAGGGACGCAAGAAGG + Intergenic
910170957 1:84376541-84376563 CTAAATAGAGGAATGGAAGATGG - Intronic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912772071 1:112473187-112473209 CAGGAGAGAGGGAGGGAAGGAGG + Intronic
912905898 1:113706936-113706958 CTGTATAGAGGGAGGCAGATGGG - Intronic
913183889 1:116349016-116349038 ATTGAGAGAGGGAGGGAAGAAGG + Intergenic
914900431 1:151708621-151708643 CTGTGCAGGGGCAGGGAAGAGGG + Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916667696 1:166981487-166981509 GTGTAGAGAGGGAGGGAGGGAGG + Intronic
916858718 1:168779552-168779574 GTGCATAGAAGGAGGGAATAAGG - Intergenic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918302535 1:183217002-183217024 CAGTAGAGAGGGAGCTAAGAAGG + Intronic
918502853 1:185217600-185217622 CTCTAGAGAGGAAGGGAGGAAGG - Intronic
919757614 1:201075616-201075638 CTGTATGGAGGGAGGATAGAGGG + Intronic
919911087 1:202111124-202111146 GTGAATAGAGGGAGTGAGGAAGG + Intergenic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920301243 1:204990380-204990402 GTGCACATAGGGAGGGAAGAAGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920703910 1:208238023-208238045 TAGTATAGAGGGATAGAAGAAGG - Intronic
921431334 1:215069511-215069533 ATGGAAAGAGGGAAGGAAGATGG - Intronic
921771901 1:219050465-219050487 AAGGAGAGAGGGAGGGAAGAAGG + Intergenic
922939289 1:229447589-229447611 CAATATCCAGGGAGGGAAGAGGG + Intronic
922995165 1:229951610-229951632 AGGAAAAGAGGGAGGGAAGAAGG + Intergenic
923509779 1:234640467-234640489 GGGCAGAGAGGGAGGGAAGAAGG + Intergenic
923682848 1:236132906-236132928 CAGTATAGAGGCAGGGTAGGAGG + Intergenic
1063150633 10:3333268-3333290 CAGTATAGGGGAAGAGAAGATGG + Intergenic
1063377189 10:5561410-5561432 CTGCAGAGAGGGGAGGAAGAGGG + Intergenic
1063926841 10:10986869-10986891 CTATATCAAAGGAGGGAAGAAGG + Intergenic
1064769768 10:18711416-18711438 GTGTACAGAGGGAGGGAGAAGGG - Intergenic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065423004 10:25567912-25567934 CTGTATAGTGGCAGTGAGGATGG + Intronic
1065918226 10:30369504-30369526 CTTTGTAGAGGGAGGGATGTGGG - Intronic
1066533727 10:36367515-36367537 AAGGAGAGAGGGAGGGAAGAAGG + Intergenic
1066700746 10:38125494-38125516 CTGCATGGAGGGAGAGGAGATGG + Exonic
1067181059 10:43986306-43986328 CAGTATATAGGGTGGGATGAGGG - Intergenic
1067781764 10:49212832-49212854 AGGGAGAGAGGGAGGGAAGAAGG + Intergenic
1067956819 10:50800702-50800724 GAGAATAGAGGGAGGGAAAAAGG + Exonic
1068116897 10:52745980-52746002 CTGTCAAGGGGGTGGGAAGAGGG - Intergenic
1068543132 10:58318673-58318695 CTGGAGAGAGGAAAGGAAGAAGG - Intergenic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1068735621 10:60410465-60410487 AAGGATGGAGGGAGGGAAGAAGG + Intronic
1069169838 10:65212862-65212884 AAGTAAGGAGGGAGGGAAGAAGG + Intergenic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069658589 10:70108523-70108545 CTGATAAGAGGGAGGCAAGAAGG - Intronic
1069811803 10:71166248-71166270 CTTAATAGAGGGTGGGAGGAAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070560551 10:77563573-77563595 CAGGATGGAGGGAGGGTAGAAGG - Intronic
1070589859 10:77794165-77794187 CTGGACAGAGGAAGGAAAGAGGG - Intronic
1071406354 10:85337032-85337054 CCTCACAGAGGGAGGGAAGAAGG + Intergenic
1072213067 10:93264598-93264620 TTTGATAGAGGGATGGAAGAAGG - Intergenic
1073191192 10:101651606-101651628 CCTTATAGAGGGAGGGAAGGAGG - Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1074204496 10:111271181-111271203 CACTATAGAGGGATGGAACAAGG + Intergenic
1074485059 10:113868258-113868280 CAGGAAAGAGGGAGAGAAGAGGG - Intronic
1074592522 10:114826632-114826654 CTTTAGAGAGGCAGAGAAGATGG + Intronic
1074708075 10:116153310-116153332 ATGTATAAAGGGAGGAAGGATGG - Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076023252 10:127091595-127091617 TTGTTTAGAGGGAGGGAGAAGGG + Intronic
1076069146 10:127472208-127472230 GAGGATAGAGGGAGGGAAGGTGG + Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077268590 11:1664676-1664698 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1078030542 11:7746660-7746682 CTCTACTGAGGGAAGGAAGAAGG + Intergenic
1078350671 11:10590546-10590568 CTGTCTTGAGGCAAGGAAGAAGG + Intronic
1078579464 11:12527259-12527281 AGGAATAGAGGGAGGGAAGGAGG + Intronic
1078716708 11:13846606-13846628 AAGTATAGAGGGAGGGAGGGAGG + Intergenic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1078859323 11:15232738-15232760 CTTGTAAGAGGGAGGGAAGAGGG + Intronic
1079321590 11:19455995-19456017 CTGCAGAGGGGGAGGGAAGGAGG + Intronic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1082758812 11:57106197-57106219 CTGTAAAAAGGGAGGAAAGGGGG + Intergenic
1082800818 11:57413724-57413746 CTGGAGAGAGAGAGGTAAGAAGG - Intronic
1082927423 11:58564787-58564809 CTGCATAGAGGATGGGAAGTGGG + Intronic
1083051840 11:59784335-59784357 CAGGATTGAGGGAGGGAAAAAGG - Intronic
1083308370 11:61772303-61772325 CTCCCTAGAGGGAGGGAGGAGGG + Intronic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084455254 11:69264572-69264594 CAGTAAGGAGGGAGGGAACAAGG + Intergenic
1084692594 11:70735720-70735742 ATGTGCAGAGGGAGGGAAGTGGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1085809468 11:79667308-79667330 CGCTAAAGAGGGAGGGAAGCAGG + Intergenic
1086129088 11:83382643-83382665 TTGTATAGAGGCAGTGCAGAGGG - Intergenic
1086340236 11:85841669-85841691 GAGTATGGAGGGTGGGAAGAGGG + Intergenic
1087037344 11:93768693-93768715 CTTCATAGAGGAAGGGGAGATGG + Intronic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089107782 11:116028555-116028577 CTGTATACAGTGAGAGATGAGGG - Intergenic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090077823 11:123590595-123590617 TGGCAGAGAGGGAGGGAAGAAGG - Intronic
1090089430 11:123681772-123681794 CAGGAAGGAGGGAGGGAAGAAGG + Intergenic
1090157204 11:124452546-124452568 TTGTATAGAGTGAGAGATGAGGG - Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1092579759 12:9826261-9826283 GAGGATAGAGGGTGGGAAGAGGG - Intergenic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1093819331 12:23593829-23593851 CTGGAAAGAGGTAGAGAAGAAGG + Intronic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1095475873 12:42587317-42587339 ATGGAGAGAGGGAGGGAAAAAGG - Intronic
1096194089 12:49637710-49637732 CTGTAAGGAGGGAGGGAGGGGGG - Exonic
1099134902 12:78885302-78885324 AAGGAGAGAGGGAGGGAAGAAGG + Intronic
1100778897 12:98002844-98002866 ATGGAAGGAGGGAGGGAAGAGGG + Intergenic
1102011575 12:109622321-109622343 CTGTATAGTGGGAGGGATTTGGG + Intergenic
1102149499 12:110679081-110679103 CTCTACAGAAGGAGGAAAGAGGG - Intronic
1102167939 12:110820966-110820988 AGCTAGAGAGGGAGGGAAGAGGG - Intergenic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1103105385 12:118219939-118219961 TTGGAGAGAGGGAGGAAAGAAGG - Intronic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103277244 12:119722800-119722822 CTGAATGGAGGGAAGAAAGAAGG - Intronic
1104498553 12:129263627-129263649 ATATAGAGAGGGAGGGAGGAAGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105211653 13:18260691-18260713 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105433210 13:20356390-20356412 CTGTTTGGAGGCAGGGAAGGAGG - Intergenic
1106874879 13:34060687-34060709 CAGTTCAGGGGGAGGGAAGAAGG - Intergenic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107596112 13:41964678-41964700 TTATAGAGAGGGAGGGAAAAAGG + Intergenic
1109734866 13:66469483-66469505 AGGAATAGAAGGAGGGAAGAAGG + Intronic
1112359460 13:98704434-98704456 GTCTATAGAGGGAGGGAAAGAGG + Exonic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113849275 13:113408854-113408876 CTGCAGAGAGGAAGGGAGGAGGG + Intergenic
1113849300 13:113408948-113408970 TTGCAGAGAGGGAGGAAAGAGGG + Intergenic
1114498213 14:23148597-23148619 CTTTCAAGAGGGAGGCAAGAAGG + Intronic
1115149169 14:30264004-30264026 CTATATGGAGGGACGGAAGGAGG + Intergenic
1116734033 14:48665898-48665920 GTGTATAGAGGGTGGGATGGAGG - Intergenic
1116924888 14:50624514-50624536 CTGCAGAGAGGGAGGGATGGGGG - Intronic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1117489860 14:56235701-56235723 TTTTATAGAAGGATGGAAGATGG + Intronic
1118294551 14:64557163-64557185 ATATATAAAGGTAGGGAAGATGG + Intronic
1118689871 14:68328051-68328073 AGGTATATAGGAAGGGAAGAAGG - Intronic
1119769145 14:77209614-77209636 GTGTAAAGAGGGTGGGAACAAGG + Intronic
1120073557 14:80130419-80130441 CTGTATAGAGGTAGCTAAAATGG - Intergenic
1120545772 14:85809414-85809436 ATGTAGAGAGGTAGGGAATAGGG + Intergenic
1120796746 14:88641783-88641805 GTGTCTAGAGAGAGGGCAGATGG - Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1120884483 14:89441191-89441213 CTGAATCGAGGCAGGGAGGAGGG - Intronic
1121016195 14:90550806-90550828 CTGGATAGATGGAGGGATGGAGG + Intronic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1124348319 15:28937146-28937168 CGGTATAGAGGGGTGGATGATGG - Intronic
1124792812 15:32745839-32745861 CTTTATGGAAGGATGGAAGAGGG + Intergenic
1125185358 15:36923849-36923871 CTGTATGGAGGGAGGTGACATGG - Intronic
1126059318 15:44764325-44764347 CTGTATAGAGGGAGAGTATATGG - Intronic
1126066184 15:44827927-44827949 ATGGATGGAGGGAGGGAAGGAGG - Intergenic
1126093648 15:45072636-45072658 ATGGATGGAGGGAGGGAAGGAGG + Intronic
1127272378 15:57413242-57413264 AGGAATGGAGGGAGGGAAGAAGG - Intronic
1127613804 15:60663137-60663159 CTATAGAGAGTGAGGGAAGCTGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129949194 15:79571253-79571275 ATGTAGAGAGGGAGGGAAGGGGG - Intergenic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131169928 15:90170618-90170640 CTGTTTAGAGGGCTGGAAGGAGG + Intronic
1131246625 15:90799874-90799896 CTTAATAGAGGAAGGGGAGAAGG + Intronic
1131508246 15:93034556-93034578 CGGAAGAGAGGGAGGGAAGAGGG + Intergenic
1131618636 15:94043359-94043381 CAGTATAGAGGTCAGGAAGAGGG + Intergenic
1132934311 16:2473245-2473267 CTGCAGAGAGGGAGGGAGAATGG - Intronic
1132955718 16:2592296-2592318 CTGTTTTGAGGGAGCCAAGATGG + Intronic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1133826205 16:9280443-9280465 CTGGATGGTGGGTGGGAAGAGGG + Intergenic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1135728194 16:24873232-24873254 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
1135829118 16:25757998-25758020 CTGGAGAGAGGCAGGGGAGAAGG - Intronic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136621345 16:31430700-31430722 CTCTAGAGAGGCAGGTAAGATGG - Intergenic
1137244626 16:46692504-46692526 CTGTATAGAAGCAGTGAACATGG + Exonic
1137598758 16:49742324-49742346 CAGATGAGAGGGAGGGAAGAGGG + Intronic
1138339623 16:56280224-56280246 CTGCTTAGTGGGAGTGAAGATGG + Intronic
1138664073 16:58548499-58548521 CTGTATAGAGTTAAGGAACATGG - Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140257540 16:73349840-73349862 AGGAAGAGAGGGAGGGAAGAAGG - Intergenic
1140609118 16:76577061-76577083 TTGTATAGAGGAAGGCAAGTGGG + Intronic
1140914246 16:79480605-79480627 CACTATGGAGGGAGGGTAGAAGG + Intergenic
1141110231 16:81265833-81265855 GTGTATAGATGGTGGGTAGATGG - Intronic
1141161041 16:81629394-81629416 CTGTATAGAGTGAGGGAGTCAGG - Intronic
1141338638 16:83181637-83181659 CTGAAAAGAGGGGGAGAAGAGGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141708375 16:85682741-85682763 CTGTAGAGGGGGAGGGCTGAGGG - Intronic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1144237287 17:13273936-13273958 CAGAATATAGGGAGGGAAGGAGG - Intergenic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1145069423 17:19790568-19790590 CAAGAAAGAGGGAGGGAAGAAGG + Intronic
1145263095 17:21366299-21366321 CTAAGTAGAGGGAGGCAAGAGGG - Intergenic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1148190873 17:45677875-45677897 GTGGACAGATGGAGGGAAGAAGG - Intergenic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1149083866 17:52691016-52691038 CTGTTTGGAGGTAGGGAAGGAGG + Intergenic
1149864838 17:60145535-60145557 AGGCATAGAGGGTGGGAAGAGGG + Intergenic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1150822208 17:68444842-68444864 AGGAATGGAGGGAGGGAAGAAGG - Intronic
1151261672 17:72920586-72920608 TTGTAGAGGGGGTGGGAAGAGGG - Intronic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152703687 17:81832460-81832482 GTGTAGAGAGGGTGGGAAGTGGG - Intronic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1154170823 18:12048700-12048722 CTGGCTACAGGAAGGGAAGAAGG - Intergenic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157552076 18:48588932-48588954 ATGTAGAGAGGGAGGGGAAAGGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158643334 18:59221046-59221068 CTGGAAAGAGGGAGGGCAAAAGG - Intronic
1158865630 18:61635573-61635595 CTGGAAAGAGAAAGGGAAGAAGG - Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159841901 18:73407738-73407760 CTCTAGAAAGGGAGGGAAGGAGG - Intergenic
1160984512 19:1832099-1832121 CTTTAAAGAGGGAGGCAGGAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162045053 19:7993658-7993680 GTGTTTAGAGGCAGGGATGAGGG - Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162183690 19:8888387-8888409 GCATAGAGAGGGAGGGAAGAGGG + Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1163214794 19:15868476-15868498 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163738586 19:18996914-18996936 CTCTTGAGAGGGAGGGAGGAAGG + Intronic
1165159588 19:33808198-33808220 CTGGATAGAGGAAGGAATGAAGG - Intronic
1166145054 19:40828372-40828394 CTTTTTAGAGGGAGGCAGGAGGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
926448216 2:12970445-12970467 TTATAAAGAGGGAGGCAAGAAGG + Intergenic
926872050 2:17431169-17431191 GTGTATAAAGGGAGGAAAAATGG - Intergenic
927061843 2:19430417-19430439 CAGTATACAGGGAAGGAAGTTGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928306534 2:30174478-30174500 CTGTCCAGAGGGAGTTAAGAGGG - Intergenic
928426614 2:31183803-31183825 AGGGAGAGAGGGAGGGAAGAAGG - Intronic
929245059 2:39692625-39692647 CTATAAAGGGGGAGGGGAGAGGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929865684 2:45715494-45715516 CTGGATAGATGGAAGCAAGAGGG - Intronic
930095879 2:47566365-47566387 GTGTATAGAGGAGGGGAAGAAGG - Intronic
930366499 2:50446350-50446372 GTGAAAAGAGGGAGGGAGGAAGG - Intronic
932256212 2:70289514-70289536 CTGTAAAGAGTGAGGGAGTAGGG + Intronic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
933803782 2:85983344-85983366 CTGTAAAGAAGGAGTGAAGCTGG - Intergenic
934301968 2:91781764-91781786 ATGGATAGAGGGAGGGAGGGAGG - Intergenic
934681020 2:96284005-96284027 CTGGAAAGAGGGAGGGAGGGAGG + Intronic
934929049 2:98405137-98405159 GGGAAGAGAGGGAGGGAAGAAGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936593350 2:113824731-113824753 CTGAATAGAGGGACGTGAGAGGG - Intergenic
936613589 2:114026112-114026134 GAGGATAGAGGGTGGGAAGAGGG + Intergenic
937089354 2:119195776-119195798 AGGGAGAGAGGGAGGGAAGAGGG + Intergenic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
939010268 2:136838273-136838295 GGGTATAGAGGGAAGGAGGAGGG + Intronic
939473797 2:142659376-142659398 CTTTAAAGAGTGAGGGGAGAAGG - Intergenic
940205228 2:151195174-151195196 CTATACAGAGGGAGTGAGGATGG - Intergenic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
942129182 2:172861407-172861429 GTGGTTAGAGGGAGGGAAAAGGG + Intronic
942730977 2:179060544-179060566 TTGGATAGATGAAGGGAAGAGGG - Intergenic
943330757 2:186556296-186556318 AGGAATAGAGGGAGGGAGGAAGG - Intergenic
944535664 2:200707267-200707289 ATGTATAGAGGAAGGGATGTGGG + Intergenic
944635254 2:201670119-201670141 ATGGAGAGAGGGAGGGAGGAAGG + Intronic
946059191 2:216927241-216927263 CTGTAAAGAGGAAGGGACAAAGG - Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
948122090 2:235538477-235538499 GTGCACAGAGGGTGGGAAGAGGG + Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948650162 2:239438196-239438218 TTGTATAGTGAGAGGTAAGATGG + Intergenic
948712654 2:239834529-239834551 CTCTAAAGAGGCAGGGAACACGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170148092 20:13199394-13199416 ATGCATGGAGGGAGGGAAGGAGG - Intergenic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170795169 20:19540800-19540822 CTATATAAAGGGACGGAAGATGG - Intronic
1172330707 20:34074463-34074485 CTGGACAGAGGGAGAGAAGCAGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173530930 20:43769152-43769174 CTATAGAAAGGGAGGGAAGGAGG + Intergenic
1173966746 20:47118236-47118258 CTGAAAAGAGAGAGGGAAGGGGG - Intronic
1174045185 20:47728149-47728171 CCGGAGAGGGGGAGGGAAGATGG + Intronic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175983987 20:62755192-62755214 ATGGATGGAGGGAGGGATGAAGG - Intronic
1175984022 20:62755320-62755342 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1175984136 20:62755659-62755681 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984188 20:62755810-62755832 ATGGATGGAGGGAGGGAGGATGG - Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176372823 21:6072826-6072848 GTGGATCGGGGGAGGGAAGAAGG - Intergenic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1177746394 21:25219668-25219690 CTGCATTGATGGAGGGTAGAAGG - Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1178191520 21:30287519-30287541 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1178323287 21:31622534-31622556 GTGTCTACAGGGAGGAAAGAGGG - Intergenic
1179750654 21:43465417-43465439 GTGGATCGGGGGAGGGAAGAAGG + Intergenic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1180814461 22:18780959-18780981 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
1181200649 22:21215295-21215317 ATGGATAGAGGGAGGGAGGGAGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1182651316 22:31853418-31853440 CTGAATAGAGGTAGAGTAGAGGG + Intronic
1183312650 22:37119209-37119231 CGGTAGAGAGGGAGGGAGAAAGG - Intergenic
1183358236 22:37370611-37370633 GTGGAGAGAGGGAGGGAGGAAGG + Exonic
1183898189 22:40985726-40985748 CTATATAGAGGGTGGGATTAGGG - Intergenic
1184293427 22:43509788-43509810 ATGGAAAGAGGGAGGGAAGGAGG - Intergenic
1184511569 22:44936394-44936416 CGGTATACAGGGAGAGATGAGGG - Intronic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
1184769282 22:46588338-46588360 CTGCCTGGAGGGATGGAAGACGG - Intronic
1203226268 22_KI270731v1_random:80140-80162 ATGGATAGAGGGAGGGAGGGAGG - Intergenic
1203264560 22_KI270734v1_random:6646-6668 ATGGATAGAGGGAGGGAGGGAGG + Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
950984100 3:17341909-17341931 CTGTATTGGGGATGGGAAGAGGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
954759112 3:52861242-52861264 CTGAACAGAGAGAGGGGAGAAGG + Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955060511 3:55488479-55488501 CTGGAAAGAGAGAGGGAAGGGGG + Intronic
955421594 3:58743704-58743726 CTGCCTAGAGGAAGGGAGGATGG + Intronic
956074632 3:65491695-65491717 GTGTATAGAGGGAAGGGAGGGGG - Intronic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956515492 3:70042017-70042039 CTTTTTTGAAGGAGGGAAGATGG + Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
957996210 3:87692882-87692904 CTGTATAGCAGGAGTCAAGATGG - Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
959667823 3:108941438-108941460 CTTTACAGAGGGAGGTAAAATGG - Intronic
959760948 3:109964279-109964301 CTCCAAAGAGGGAGGGCAGAGGG + Intergenic
959932096 3:111996280-111996302 GTGGATAGAGTGAGGCAAGAGGG - Intergenic
960540420 3:118855422-118855444 CTGTATAATGGAAGAGAAGAAGG - Intergenic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961799579 3:129436117-129436139 CTGGAAAGAGGATGGGAAGAAGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962495403 3:135934867-135934889 CTGCATAGAGGAAGGGTAGGGGG - Intergenic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963225842 3:142860840-142860862 CTGGATAGAGGGTGGGCAGGAGG - Intronic
963284240 3:143417539-143417561 ATGGATGGAGGGAGGGAAAAAGG + Intronic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964682518 3:159358158-159358180 CTAAAGAGAGGGAGGTAAGAAGG + Intronic
964761634 3:160140118-160140140 CTGTACAGAGGAAGGGTAAATGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
965698564 3:171436151-171436173 CTGTATAGGAGTGGGGAAGATGG - Intronic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
966736016 3:183187860-183187882 CTGGGTAGGGGAAGGGAAGAAGG - Intronic
967873955 3:194253653-194253675 CTTTATGGAGGGCGGGGAGAAGG - Intergenic
968910327 4:3474044-3474066 GGGAATAGAGGGAGGGGAGAGGG + Intronic
969198021 4:5578651-5578673 GTGGATGGAGGGAGGGAAAAGGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
970126082 4:12813022-12813044 TTGTACAGAGTGAGAGAAGATGG + Intergenic
970463817 4:16303643-16303665 CTGTATATAAGAAGTGAAGATGG - Intergenic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
971954844 4:33403473-33403495 TTGGATAGAGGGAGGGAGGGAGG - Intergenic
972374654 4:38459193-38459215 ATGTATGGAGGGAGGAGAGAGGG + Intergenic
972693213 4:41419818-41419840 AGGAAGAGAGGGAGGGAAGAGGG - Intronic
972889741 4:43542311-43542333 ATGGAGAGAGGGAGGAAAGAAGG - Intergenic
973696900 4:53499076-53499098 CTGTTTAGAGCAAGGGAAGGAGG - Intronic
974078105 4:57185906-57185928 TTGGATAGAGTGAGGGATGAGGG + Intergenic
974393830 4:61309336-61309358 CTTGATAGAGGGAGTGAAAAAGG - Intronic
974424890 4:61729050-61729072 TTGTAGAGAGGGAGGGAGGGGGG + Intronic
974883066 4:67783382-67783404 CTGAAAAGAGGGAGATAAGAAGG - Intergenic
975376761 4:73655075-73655097 TTGTACTGAGGGAGGAAAGAAGG + Intergenic
976008774 4:80461902-80461924 GTTTATAGATGGAGGGAAGTGGG - Intronic
976619338 4:87112319-87112341 GGGCAGAGAGGGAGGGAAGAAGG - Intronic
976676044 4:87704631-87704653 ATGAATAGGGGAAGGGAAGAGGG + Intergenic
976954046 4:90872266-90872288 CAGGATAGAAGGTGGGAAGAAGG - Intronic
977027816 4:91842587-91842609 CAGGACAGAGGGTGGGAAGAGGG + Intergenic
977978703 4:103297389-103297411 CTGGATGGAGGGTGGGAGGAGGG - Intergenic
979414085 4:120415507-120415529 CTGTATTGAGGGAAAAAAGAAGG + Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
981676636 4:147350366-147350388 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982585383 4:157230594-157230616 ATGGATGGAGGGAAGGAAGAAGG - Intronic
982846839 4:160263843-160263865 GGGGATAGAGAGAGGGAAGATGG - Intergenic
983273095 4:165586485-165586507 CTATATAGGGGATGGGAAGAAGG - Intergenic
983274207 4:165598010-165598032 AGGGAGAGAGGGAGGGAAGAAGG - Intergenic
983964648 4:173794931-173794953 CGTTATGGAGGGAGAGAAGAGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985851596 5:2392494-2392516 AAGAAGAGAGGGAGGGAAGAAGG - Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987288671 5:16487327-16487349 CTGGCGAGAGGGAGGGGAGATGG - Intronic
988809796 5:34773228-34773250 TTGTATATAGGGAGAGAGGAGGG - Intronic
989445467 5:41523407-41523429 CTGTATAGGGGGATGCAAAAGGG - Intergenic
990313069 5:54558361-54558383 ATGGAGAGAGGGAGGGAAGGAGG - Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990785268 5:59411631-59411653 CTTTATAAAGGGAGGGAATTTGG - Intronic
990890838 5:60648211-60648233 CTGTTTTGAGGCAGGAAAGAGGG - Intronic
991122278 5:63030505-63030527 CTTCATTGATGGAGGGAAGAAGG - Intergenic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991611568 5:68454982-68455004 CTTCAGAGTGGGAGGGAAGACGG + Intergenic
992186414 5:74248957-74248979 AGGAATGGAGGGAGGGAAGAAGG + Intergenic
992215411 5:74520170-74520192 TTGCTTAGAGGTAGGGAAGATGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
992603562 5:78431739-78431761 CTGTATAAAGGTTGGGAAGGGGG - Intronic
992936270 5:81709440-81709462 CTGCATATAGGTAGAGAAGATGG - Intronic
994038160 5:95226168-95226190 GGGTAAAGAGGGAGGGAAAATGG - Intronic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
995168557 5:109078199-109078221 CTGTATATAGGGAGTATAGAGGG - Intronic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996815224 5:127566718-127566740 CTTCATAGGGGAAGGGAAGATGG - Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997701002 5:135899366-135899388 CTGTACAGAGGGAAGGGAGCAGG + Intergenic
998077477 5:139248253-139248275 CTTTATGGAGGGAGGGAAGGAGG + Intronic
998695912 5:144639358-144639380 TTTTATAGAGAGAGAGAAGAAGG + Intergenic
998834515 5:146190671-146190693 AGGAAGAGAGGGAGGGAAGAAGG + Intergenic
999088090 5:148911091-148911113 CTGCATTGTGGGAGGGCAGATGG - Intergenic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000579844 5:163022673-163022695 AGGGATGGAGGGAGGGAAGAAGG + Intergenic
1000629377 5:163574322-163574344 GGGAATGGAGGGAGGGAAGAAGG - Intergenic
1001919408 5:175588643-175588665 AAGGAGAGAGGGAGGGAAGAAGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003783424 6:9455919-9455941 ATGTAGAGAGGGATGGAAGAGGG + Intergenic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1004419212 6:15453059-15453081 ATGTATTGAGTGAGGGATGATGG - Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005811167 6:29517585-29517607 TTTTATAGATGGAGGGAAGGAGG - Intergenic
1005856312 6:29865632-29865654 CTGTACACTGGGAGGGAAGATGG + Intergenic
1006293683 6:33160223-33160245 ATGTATAGAGGGAGGGCTGTGGG - Intergenic
1006757631 6:36430458-36430480 CCTTAGAGAGGGAGGCAAGAGGG + Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006830956 6:36968026-36968048 CTGTAAAGAGGCAGGGCAGGGGG - Intergenic
1007160483 6:39787855-39787877 GGGTATAGAGGTAGGAAAGAGGG + Intergenic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007865605 6:44966145-44966167 CTGAATAGAGGCAGAGGAGAAGG - Intronic
1008086037 6:47245186-47245208 CTATACAGAGGGATGGAAGTGGG - Intronic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1008675536 6:53813983-53814005 CTGTATAGAGGAAAGGAGCAAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1009894661 6:69733615-69733637 GTGTATAGAGGGAGGGGAAGAGG - Intronic
1010147300 6:72684982-72685004 CAATATAGAGGGAGGGACAATGG - Intronic
1010168140 6:72941427-72941449 ATGAAGAGAGGGAGGGAAGGAGG - Intronic
1010767475 6:79792867-79792889 ATGTATACAGGGTTGGAAGAGGG - Intergenic
1011841189 6:91501065-91501087 AGGGATGGAGGGAGGGAAGAAGG - Intergenic
1012324044 6:97891958-97891980 CTGAATAGAGGAAGGAGAGAAGG - Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012789755 6:103677681-103677703 CTGTATAGAGGGGGGATTGAGGG - Intergenic
1013088110 6:106874026-106874048 CTGAAAAGAGTGTGGGAAGAAGG - Intergenic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1014125154 6:117768751-117768773 CTTTATAGAGGTATGGAGGATGG - Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1014217029 6:118762261-118762283 CTGGATGGAGGGAGGGGACAAGG - Intergenic
1014709217 6:124786918-124786940 CTGTATAAAGGGAAGTAACACGG - Intronic
1014763065 6:125379244-125379266 CTGAAAAGAGGGAGGAAAGAAGG + Intergenic
1015217648 6:130768285-130768307 ATGAAAAGAGAGAGGGAAGAAGG - Intergenic
1016414208 6:143816017-143816039 CTGTTGAGAGGGAGGGAATGGGG - Intronic
1017049815 6:150379857-150379879 CTTTATAGAGGAAGAGGAGATGG - Intronic
1018266259 6:162027861-162027883 AAGGAGAGAGGGAGGGAAGAAGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1020447854 7:8287661-8287683 ATGGAAAGAGGGAAGGAAGAAGG - Intergenic
1020614063 7:10436922-10436944 GAGTATAGATGGAGTGAAGATGG - Intergenic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021796633 7:24261912-24261934 CTGTATAGAGGGGGGAAGAATGG - Intergenic
1021809613 7:24390603-24390625 CTGCATTCAGGGTGGGAAGAGGG - Intergenic
1021971096 7:25966736-25966758 GGGAAGAGAGGGAGGGAAGAAGG + Intergenic
1022013383 7:26328538-26328560 GTGTAGAGTGGAAGGGAAGAGGG + Intronic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1022577709 7:31514299-31514321 CAATCTAGAGGGAGAGAAGAAGG - Intronic
1022592730 7:31681227-31681249 GTGGATTGAGGCAGGGAAGATGG - Intergenic
1022872116 7:34490499-34490521 AAGTATAGAGGCAGGAAAGAAGG - Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023369252 7:39496653-39496675 CTGTACAGAGTGAGGAAAGAAGG - Intergenic
1024167253 7:46747253-46747275 GTGTCTAGAGGGAGGAAGGAGGG - Intronic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026931038 7:74223119-74223141 CTGGAGAGAGGGAGGGAGGCAGG - Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1029129501 7:98319212-98319234 CTCTATAGAGCAAGGGAAGATGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029412784 7:100426674-100426696 AGGAAGAGAGGGAGGGAAGAGGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030645873 7:112061124-112061146 CTCCATAGATGGAGAGAAGAGGG - Intronic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032590504 7:133187869-133187891 CTGTATAGTGGGAGGGGTCAAGG - Intergenic
1033096271 7:138433948-138433970 AGGGAGAGAGGGAGGGAAGAAGG + Intergenic
1033806143 7:144956105-144956127 CTGCATAGATGGAGGGGACAGGG - Intergenic
1035818922 8:2570760-2570782 ATGGAAAGAGGGAGGGAAGGAGG + Intergenic
1037993743 8:23338575-23338597 CTGCATGGCGGGAGGGAAGGGGG + Intronic
1038338982 8:26668414-26668436 CAGTAAAGAGGGAGGCAACATGG + Intergenic
1038699180 8:29834231-29834253 CTGTTGAGGGGGTGGGAAGAGGG - Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1040434950 8:47381169-47381191 GGGTACAGAGGGAGGGAAGGAGG - Intronic
1041110440 8:54477966-54477988 CCTTAGAGAGGGAGGGGAGAAGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041866565 8:62581728-62581750 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1043766856 8:84146368-84146390 CTGGACAGAGGGAGGGGGGAAGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1045718315 8:105074893-105074915 CGGGAGGGAGGGAGGGAAGAAGG - Intronic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046713856 8:117545725-117545747 CTGAATAGAGGGTGAGAATATGG + Intergenic
1046719985 8:117608446-117608468 AAGAAGAGAGGGAGGGAAGAGGG - Intergenic
1046892894 8:119442417-119442439 CTGAATTGGGGGTGGGAAGATGG + Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1048161084 8:132022718-132022740 TTGATTAAAGGGAGGGAAGAAGG + Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049475936 8:142797012-142797034 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1050396898 9:5207887-5207909 CTGTATAAAGGCAGGGAAAGTGG - Intergenic
1050437704 9:5628181-5628203 CTGAATAGAAGGAGGGTTGAGGG - Intergenic
1050749113 9:8916237-8916259 AGGTAGAGAGGGAAGGAAGAAGG + Intronic
1050871283 9:10573478-10573500 TTGTATGGAGGAAGGCAAGATGG + Intronic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1051860112 9:21615134-21615156 CTGTATAGAGGAAGAGGAGGGGG + Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1052696085 9:31880585-31880607 TGGTATAGAGGGAGGGACCACGG + Intergenic
1053369462 9:37548609-37548631 GGGTAGAGAGGGAGGGAAGGAGG - Intronic
1053618726 9:39794826-39794848 CAGTATAGAGGTAGGGAGCATGG - Intergenic
1054265429 9:62912603-62912625 CAGTATAGAGGTAGGGAGCATGG + Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1057906538 9:98987791-98987813 ATCCTTAGAGGGAGGGAAGAAGG - Intronic
1058212254 9:102183790-102183812 ATGTAGAGAGGAAGAGAAGAAGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059364292 9:113773910-113773932 AGGAAGAGAGGGAGGGAAGAGGG + Intergenic
1060129270 9:121079022-121079044 CTAGAAAGAGGGAGGGGAGAGGG - Intronic
1060371114 9:123072547-123072569 TTGTTTAGAGTGAGGGGAGATGG + Intronic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1061461588 9:130743873-130743895 CTGTAAAGAGGTAGGGGAGGTGG + Intronic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1186206321 X:7204619-7204641 AGGAAGAGAGGGAGGGAAGAAGG - Intergenic
1186497422 X:10022711-10022733 CTTACTAGAGGGAGGGAGGAGGG + Intronic
1186653487 X:11587537-11587559 TGGTATAGAAGGATGGAAGATGG + Intronic
1186733334 X:12433903-12433925 CTTTATAGGTGGAGAGAAGAAGG + Intronic
1186733370 X:12434344-12434366 CTTTATAGGTGGAGAGAAGAAGG - Intronic
1186754711 X:12658374-12658396 ATGCATAGAGGCAGGAAAGAAGG + Intronic
1187264498 X:17718738-17718760 AAGGAAAGAGGGAGGGAAGAAGG + Intronic
1187716774 X:22110597-22110619 CTGCATAGAGGGAGGGGGGAGGG - Intronic
1187991495 X:24878480-24878502 CTGAATAAAGGCAGGGGAGAGGG + Intronic
1188285715 X:28323352-28323374 CTTCATAGAGGAAGGGGAGATGG - Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1189224082 X:39398234-39398256 AGGAAAAGAGGGAGGGAAGAAGG - Intergenic
1189377833 X:40479640-40479662 CTGCAGAGAGGGAGGAAAGGAGG - Intergenic
1189808467 X:44758843-44758865 ATTTATAGAGAGAGGGAACAGGG + Intergenic
1190151766 X:47955591-47955613 CTTTATAGATGGAGCGAACACGG - Intronic
1190180806 X:48190722-48190744 ATGTATACAGGGAAGGGAGAGGG + Intronic
1190196473 X:48323593-48323615 ATGTATACAGGGAAGGGAGAGGG - Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1192094984 X:68201210-68201232 CATTTTTGAGGGAGGGAAGATGG - Intronic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1193748574 X:85314102-85314124 CTGGCTAGTGGTAGGGAAGAGGG + Intronic
1193757860 X:85430471-85430493 AAGAAAAGAGGGAGGGAAGAAGG - Intergenic
1194100497 X:89697336-89697358 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1194689564 X:96967186-96967208 GAGAACAGAGGGAGGGAAGAGGG - Intronic
1194756034 X:97741193-97741215 CTCCAGAGAGGGAGGGAAGAGGG - Intergenic
1194801859 X:98283671-98283693 GTGTGTAGAGGAAGGAAAGAAGG - Intergenic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1196190796 X:112792209-112792231 AGGTATAGAGATAGGGAAGAAGG - Intronic
1196287071 X:113895489-113895511 TTGGATAGAGGGAGGACAGAAGG - Intergenic
1196892580 X:120305679-120305701 GGGGATAGAGGGAGGGGAGAGGG + Intronic
1197150304 X:123213420-123213442 TTGTACAGATGAAGGGAAGAAGG + Intronic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197990897 X:132315985-132316007 GAGGATAGAGGGTGGGAAGAGGG + Intergenic
1198734105 X:139767391-139767413 ATATATAGAGGGAGAGGAGAAGG + Intronic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1198864101 X:141102935-141102957 ATGTATATAGGAATGGAAGAAGG - Intergenic
1198898588 X:141484481-141484503 ATGTATATAGGAATGGAAGAAGG + Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200453452 Y:3358398-3358420 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic