ID: 996552110

View in Genome Browser
Species Human (GRCh38)
Location 5:124741930-124741952
Sequence TTGGCACAGGGGCCCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996552110_996552120 20 Left 996552110 5:124741930-124741952 CCTTTGAGGGGCCCCTGTGCCAA 0: 1
1: 0
2: 1
3: 12
4: 134
Right 996552120 5:124741973-124741995 GGCACAGCTTCCTCTGGTATAGG 0: 1
1: 0
2: 0
3: 10
4: 148
996552110_996552116 -4 Left 996552110 5:124741930-124741952 CCTTTGAGGGGCCCCTGTGCCAA 0: 1
1: 0
2: 1
3: 12
4: 134
Right 996552116 5:124741949-124741971 CCAACTCCAGTGGCTAAGATTGG 0: 1
1: 0
2: 2
3: 24
4: 369
996552110_996552117 -1 Left 996552110 5:124741930-124741952 CCTTTGAGGGGCCCCTGTGCCAA 0: 1
1: 0
2: 1
3: 12
4: 134
Right 996552117 5:124741952-124741974 ACTCCAGTGGCTAAGATTGGTGG 0: 1
1: 0
2: 10
3: 160
4: 1482
996552110_996552119 14 Left 996552110 5:124741930-124741952 CCTTTGAGGGGCCCCTGTGCCAA 0: 1
1: 0
2: 1
3: 12
4: 134
Right 996552119 5:124741967-124741989 ATTGGTGGCACAGCTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996552110 Original CRISPR TTGGCACAGGGGCCCCTCAA AGG (reversed) Intronic
900361830 1:2292873-2292895 TTGGCTCAGCGGCCCCGCCAGGG - Intronic
900413792 1:2525978-2526000 TTGGCAGAGTGGCCCCGAAAAGG - Intronic
900522202 1:3111179-3111201 TGGGCACAGGGGCCCAGCAGTGG - Intronic
901185882 1:7372921-7372943 TTGGCCCAGGGCCACTTCAATGG - Intronic
904473991 1:30752673-30752695 TTGGCAGACTGGCCCCTCAAGGG + Intronic
910100315 1:83568643-83568665 TTGGTACATGGGCCCCTCAAAGG - Intergenic
910159116 1:84254664-84254686 TTAGCACAGGGCCCTCACAATGG - Intergenic
911170743 1:94768801-94768823 CTGCCAGAGGGGCCCCTGAAGGG + Intergenic
912625788 1:111204019-111204041 GTGGCCCCGGGGCCCCACAACGG + Intronic
922240278 1:223751115-223751137 CGTGGACAGGGGCCCCTCAAAGG + Intronic
923143592 1:231182465-231182487 TTGGCACAGGGACCCAGAAAAGG + Intronic
924476789 1:244389439-244389461 CTGGCACTGGAGACCCTCAAGGG + Intronic
924591166 1:245406016-245406038 TTTGCACAAAGGCCACTCAAAGG + Intronic
1062927562 10:1328218-1328240 GCGGCACAGGGACCCCTCTATGG + Intronic
1064349123 10:14560235-14560257 TTGGAACAAGTGCCCATCAAAGG + Intronic
1064737650 10:18399173-18399195 TGGGGACAGGGGCCCCTTATGGG + Intronic
1067185605 10:44024589-44024611 TTGGCATGTGGGTCCCTCAAGGG + Intergenic
1067347383 10:45446393-45446415 TTGGGACAGGAGCCCCTGGAAGG + Intergenic
1067758991 10:49029104-49029126 TTGACAGAGGGTCTCCTCAATGG + Intronic
1069785336 10:70984197-70984219 TTGGTAGAGGGGCCCATCCAAGG + Intergenic
1077235705 11:1481126-1481148 TTGCCACACGGGCCCCTGCACGG + Intronic
1080085934 11:28282191-28282213 GTGGCACAGGGGTCTGTCAAAGG - Intronic
1080613022 11:33921393-33921415 TTTCCACAGTGGCCCCTCAGGGG + Intergenic
1082283660 11:50298229-50298251 GTGGCGCAGAAGCCCCTCAATGG - Intergenic
1087013935 11:93538375-93538397 GTGGCACAGGGGACCCACCAGGG - Intronic
1090400180 11:126443879-126443901 TGGGAACAGGGGCCTCCCAAAGG + Intronic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091276685 11:134357554-134357576 TTGGCCCTGGGGCCTCTCAGCGG + Intronic
1093373154 12:18388656-18388678 TTGGCCCAGGGGCACCTTATGGG + Intronic
1094042648 12:26133771-26133793 CTTGCACAAGGGCCTCTCAAAGG + Intronic
1098861509 12:75716038-75716060 CTGGCACAGTGGCCCTTCCATGG + Intergenic
1101327320 12:103727496-103727518 TTGGCACAGGGACCCCTGTCAGG + Intronic
1103894414 12:124263668-124263690 TTGCCTCAGGGGCCCCTCCCTGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1116152062 14:41154265-41154287 TTGGCGCCGGGTCCCATCAACGG - Intergenic
1119439690 14:74619832-74619854 TTGGCCCAGGGGCCCCCAAGAGG + Intergenic
1120184853 14:81383996-81384018 AGAGCACAGGTGCCCCTCAAGGG + Intronic
1123472337 15:20564717-20564739 TTGGCACAGGAGTCACTGAAAGG + Intergenic
1123645666 15:22435636-22435658 TTGGCACAGGAGTCACTGAAAGG - Intergenic
1123732642 15:23159708-23159730 TTGGCACAGGAGTCACTGAAAGG + Intergenic
1123750775 15:23357088-23357110 TTGGCACAGGAGTCACTGAAAGG + Intronic
1124283146 15:28381004-28381026 TTGGCACAGGAGTCACTGAAAGG + Intronic
1124299553 15:28530609-28530631 TTGGCACAGGAGTCACTGAAAGG - Intronic
1128126412 15:65196550-65196572 TTGGCACGTGGCCCCCACAATGG - Exonic
1129360126 15:75019355-75019377 CTGGCCCAGGGACCCCTCACGGG + Exonic
1130846044 15:87747091-87747113 ATGGTACAGGGGACCCACAAGGG - Intergenic
1132756389 16:1487439-1487461 TGAGCACAGGGGCCCCCCACAGG - Exonic
1142611411 17:1110757-1110779 TTAGCCCTGGGGCCCCTCAAGGG - Intronic
1143095343 17:4475896-4475918 TTTGCACTGGGGCTCCTCACAGG - Intronic
1143960509 17:10713763-10713785 TTGGCACAGTGGCCACTGAATGG - Exonic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1144591673 17:16529247-16529269 TGGGCATAGGGACCGCTCAACGG - Intergenic
1144789926 17:17851865-17851887 TTGGCACAGGGGCCCAAGCAAGG - Intronic
1146931699 17:36782528-36782550 GTGGCACAGCGGCACCTCCATGG - Intergenic
1147993951 17:44351309-44351331 GTGGCACTGGGGACCCTCAGGGG - Intronic
1148847494 17:50537946-50537968 TTGGCCCACGGGGGCCTCAACGG + Intronic
1148867132 17:50634677-50634699 TTGGCCCAGGGGCCGCTCGCAGG + Intergenic
1149271462 17:54983068-54983090 TTCCCACAGGAGCCCCACAAGGG - Intronic
1150606916 17:66699841-66699863 TGGGCACAGTGGCCCAGCAAAGG - Intronic
1152827877 17:82478966-82478988 ATGGCACAGGGGCCCAGGAAGGG + Intronic
1155872925 18:31049546-31049568 TTGTCACAAGGGCCTCTCTAGGG + Intergenic
1157397654 18:47356079-47356101 TTGGCCCAAGGGCCCCTCGCAGG - Intergenic
1160393928 18:78558494-78558516 GAGCCACAGGGGACCCTCAAAGG - Intergenic
1168616674 19:57843325-57843347 TGGGCACATGGTGCCCTCAAAGG - Intronic
926119952 2:10236385-10236407 GTGGAAGACGGGCCCCTCAATGG - Intergenic
926934882 2:18076998-18077020 CTGGCATAGGGGCCCCTCTGTGG - Intronic
927310407 2:21624712-21624734 TTGGCAAAGGGTTCCCTCACGGG - Intergenic
927916360 2:26939073-26939095 TTGGCCCAGGAGCCCCTCGAGGG + Intronic
927973664 2:27322091-27322113 ATGGCATAGGGCCCCCACAAAGG - Intronic
929925275 2:46202294-46202316 TTGCTGGAGGGGCCCCTCAAAGG + Intergenic
930046146 2:47175354-47175376 TAGGGACAGGGGCTCTTCAAAGG + Intronic
931628075 2:64274940-64274962 TTAGCACAGTGACCCCTCACAGG + Intergenic
932274331 2:70440704-70440726 TTGGATCAGAGGCCTCTCAAGGG + Intergenic
933944708 2:87275989-87276011 TTTGCACAAAGGCCCCACAAGGG - Intergenic
935361753 2:102251330-102251352 TTGGCACAGGGCCCCGTCTCAGG + Intergenic
936335502 2:111585589-111585611 TTTGCACAAAGGCCCCACAAGGG + Intergenic
940979861 2:159989443-159989465 TTTCCACTGGGGCCCCTCAAAGG - Intronic
941154494 2:161959528-161959550 TTGCCACAGTGGCCTCTCCATGG + Intronic
941176163 2:162199647-162199669 TTGGCACAGGAGACCCTGACAGG - Intronic
942865642 2:180671105-180671127 TCGACACAGGTGCCCATCAATGG - Intergenic
946261053 2:218491285-218491307 TTGCCACATGGCCCCCTCATAGG - Intronic
947675442 2:231975223-231975245 TTTGCACAGAGTCCCCTGAAGGG - Intronic
948687766 2:239680076-239680098 TAGGCTCAGGAGCCCCACAAAGG + Intergenic
949052778 2:241906037-241906059 TTGGCTGAGGGGTCCCTCAAGGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170901212 20:20465358-20465380 TTGGCACAGGAGGGCCTCAAGGG + Intronic
1171935553 20:31272104-31272126 TTTGCACAGGGGCCCATCCCTGG + Intergenic
1172185445 20:33028432-33028454 TTGGCTCAGAGGCCCCTTGAGGG - Intergenic
1173881248 20:46414093-46414115 TAAGCACAGGAGCCCTTCAATGG - Intronic
1174671738 20:52314371-52314393 ATGGCAGAGTGGCCCCTCACAGG + Intergenic
1175991793 20:62793524-62793546 TAGGCACAGGGGACCCCCAAGGG + Intergenic
1177256311 21:18667346-18667368 TTGGCACAAGGGCATCTTAAGGG + Intergenic
1178825169 21:36009324-36009346 TTGACACATGGTCTCCTCAATGG + Intergenic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1180190360 21:46159965-46159987 TGGCCACAGGCGACCCTCAAAGG + Intergenic
1182473008 22:30560253-30560275 TTGGTGCTGGGGCCCCTCCATGG - Intronic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1182615554 22:31586780-31586802 TTGACACAGGGGCCCAACACTGG + Intronic
1183317062 22:37142621-37142643 TTGGCACAGGGGCCCCAGCCTGG - Intronic
949605189 3:5645172-5645194 ATGGCACAGGGGCCCCTCTTAGG - Intergenic
953682917 3:45052856-45052878 TTGCCACAGAGGCCCATTAAAGG - Intergenic
956690905 3:71876977-71876999 TTGGCCCAGGGGCCACCCCAGGG + Intergenic
957234881 3:77574193-77574215 TTAGCACAAGGGCCTCTCAAAGG - Intronic
959907299 3:111724031-111724053 GTGGCAAAGGGGACCATCAAAGG + Intronic
961662879 3:128479713-128479735 CTGGGCCAGGGGCCCCTCACAGG + Exonic
962973630 3:140427368-140427390 TTGGCACATGGGCCCCCAGATGG + Intronic
963864216 3:150342893-150342915 TTGCCACATGGGCCTCTCCATGG + Intergenic
964529492 3:157651740-157651762 CTCTCACAGAGGCCCCTCAATGG - Intronic
974892397 4:67897550-67897572 TTGGCTCTGGGGATCCTCAAGGG + Intergenic
982784277 4:159523445-159523467 TGGGCAGAGGCGCCCCTCACTGG - Intergenic
985930924 5:3057270-3057292 TTGGCACAGGGAACCCAGAAAGG + Intergenic
985977540 5:3432610-3432632 TTGGCTGAGGGGCTCCTAAAAGG - Intergenic
987084919 5:14459440-14459462 TTGGCTCAGGGGCTCCACCACGG - Intronic
989494301 5:42093751-42093773 TTAGCTCAGGGGCCGGTCAATGG - Intergenic
992159540 5:73987400-73987422 TTGGCACAGTGGCTCCTACAGGG + Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
996644379 5:125796449-125796471 AAGGCCCAGGGGCCTCTCAAAGG - Intergenic
1006641529 6:35491967-35491989 GTGGCTCTGGGGCCCCTAAAGGG - Intronic
1012215806 6:96582076-96582098 TTGCCTCAGGGTCTCCTCAAAGG - Intronic
1013628192 6:111958193-111958215 CTGGGGCAGGGCCCCCTCAAGGG + Intergenic
1017996216 6:159533842-159533864 TTGGCAGAGGGGCCAAACAAAGG - Intergenic
1019336495 7:485316-485338 CTGGGACAGGGACCCATCAAAGG - Intergenic
1022959473 7:35412844-35412866 TACGCACAGGTGCTCCTCAAGGG - Intergenic
1023834177 7:44058801-44058823 TCGGCCCAGTAGCCCCTCAAAGG - Intronic
1023840699 7:44096093-44096115 AGGGCACAGTGGCCCCTCAAGGG + Intergenic
1025102971 7:56150792-56150814 TGGGCAGAGGCGCCCCTCACTGG - Intergenic
1029472589 7:100763956-100763978 TTGGCACCTGGGCTCCTCCAAGG + Intronic
1032609817 7:133400746-133400768 AGGGCACAAGAGCCCCTCAAAGG - Intronic
1036091154 8:5667132-5667154 TTAGCACAGTGGCCAGTCAATGG - Intergenic
1037829849 8:22180966-22180988 TTGGGCCAGGGGCTCCTGAAGGG + Intronic
1041258504 8:56000148-56000170 TAGACACAGGGGCTCCTCCAAGG + Intronic
1041434057 8:57817934-57817956 TTTGTCCTGGGGCCCCTCAATGG - Intergenic
1047521747 8:125600356-125600378 TGGCCACAGGGGCCACTGAATGG + Intergenic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1049234744 8:141506963-141506985 TCAGCACAGGGGCCCCTGGATGG + Intergenic
1050048922 9:1577417-1577439 TTGGCACAGGTGCAGCTGAATGG + Intergenic
1052087388 9:24284251-24284273 TTGGCTCAGGTGCCCCACACTGG + Intergenic
1055586123 9:77761187-77761209 TGGGCAGAGGCGCCCCTCACTGG - Intronic
1056085384 9:83143897-83143919 TTGACCCAGGTGCCCATCAATGG + Intergenic
1057049723 9:91914560-91914582 TGGGCACAGTGGCCGCTCCAGGG + Intronic
1061302223 9:129711955-129711977 TTCTCCCAGGGGCCCTTCAAAGG + Intronic
1062161813 9:135084728-135084750 TTGGCAAAGGATGCCCTCAAGGG - Intronic
1187512863 X:19937982-19938004 CTGGCTCAGGGTCCCCTCACTGG + Intronic
1189361237 X:40353870-40353892 TTGGCCTAGGTGCCCATCAATGG - Intergenic
1189571489 X:42302593-42302615 TTGCCACATGGGCTCCTCACAGG + Intergenic
1196989620 X:121313700-121313722 TTGGCACACGGGCCTCTAAAGGG + Intergenic
1197599222 X:128508084-128508106 TGGGCCCAGGGCCCCCTCTATGG + Intergenic
1198052064 X:132959491-132959513 TTGGCACTGGGGCCACTGAGTGG + Intronic