ID: 996555737

View in Genome Browser
Species Human (GRCh38)
Location 5:124777339-124777361
Sequence TATCTAGAGAAGGCCGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996555733_996555737 -7 Left 996555733 5:124777323-124777345 CCACAGGGAACTAGATTATCTAG No data
Right 996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996555737 Original CRISPR TATCTAGAGAAGGCCGGGTG TGG Intergenic
No off target data available for this crispr