ID: 996558906

View in Genome Browser
Species Human (GRCh38)
Location 5:124807777-124807799
Sequence ATGTCCTAATTTAAGATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996558905_996558906 15 Left 996558905 5:124807739-124807761 CCTAGGATTGGACTCAACACAAA No data
Right 996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG No data
996558904_996558906 16 Left 996558904 5:124807738-124807760 CCCTAGGATTGGACTCAACACAA No data
Right 996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG No data
996558903_996558906 26 Left 996558903 5:124807728-124807750 CCATAGCTTTCCCTAGGATTGGA No data
Right 996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG No data
996558901_996558906 27 Left 996558901 5:124807727-124807749 CCCATAGCTTTCCCTAGGATTGG No data
Right 996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996558906 Original CRISPR ATGTCCTAATTTAAGATCTA TGG Intergenic
No off target data available for this crispr